Construct: ORF TRCN0000477599
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013727.1_s317c1
- Derived from:
- ccsbBroadEn_11259
- DNA Barcode:
- CTATCTACGGGGGAGTCACAGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DPF1 (8193)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477599
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8193 | DPF1 | double PHD fingers 1 | NM_004647.3 | 52.4% | 52% | (many diffs) |
| 2 | human | 8193 | DPF1 | double PHD fingers 1 | XM_005259292.5 | 51.7% | 52% | (many diffs) |
| 3 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527357.2 | 50.4% | 50.6% | (many diffs) |
| 4 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001363579.1 | 50% | 50.2% | (many diffs) |
| 5 | human | 8193 | DPF1 | double PHD fingers 1 | XM_005259289.2 | 49.6% | 49.8% | (many diffs) |
| 6 | human | 8193 | DPF1 | double PHD fingers 1 | XM_024451731.1 | 49.5% | 49.7% | (many diffs) |
| 7 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723407.2 | 48.7% | 48.9% | (many diffs) |
| 8 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527356.1 | 48.4% | 48.6% | (many diffs) |
| 9 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723408.3 | 48.2% | 48.4% | (many diffs) |
| 10 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001135155.2 | 47.6% | 47.8% | (many diffs) |
| 11 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001289978.1 | 46.5% | 46.6% | (many diffs) |
| 12 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001135156.2 | 36.9% | 36.9% | 0_1ins165;430_431insGTGAGTCCT;433_996del |
| 13 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527358.2 | 36% | 36% | 0_1ins165;430_431insGTGAGTCCT;433_1026del |
| 14 | human | 8193 | DPF1 | double PHD fingers 1 | XR_243964.2 | 26.2% | (many diffs) | |
| 15 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540041.2 | 49.1% | 51.7% | (many diffs) |
| 16 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | NM_013874.2 | 47% | 49.4% | (many diffs) |
| 17 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540039.2 | 45% | 46.5% | (many diffs) |
| 18 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540038.3 | 44.7% | 46.8% | (many diffs) |
| 19 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540035.3 | 43.7% | 45.7% | (many diffs) |
| 20 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540034.3 | 43.6% | 45.4% | (many diffs) |
| 21 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540032.2 | 41.8% | 43.9% | (many diffs) |
| 22 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_011250588.1 | 35.2% | 36.8% | (many diffs) |
| 23 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_011250589.1 | 26.6% | 28.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 675
- ORF length:
- 606
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccacggtc atccctggcc ccctgagcct aggcgaggac ttctaccgcg 121 aggccatcga gcactgccgc agttacaacg cgcgcctgtg cgccgagcgc agcctgcgac 181 tgcccttcct cgactcgcag accggcgtgg cccagaacaa ctgctacatc tggatggaga 241 agacccaccg cgggccgggt ttggccccgg gacagattta cacgtacccc gcccgctgtt 301 ggaggaagaa acggagactc aacatcctgg aggaccccag actcaggccc tgcgagtaca 361 agatcgactg tgaagcaccc ctgaagaagg agggtggcct cccggaaggg ccggtcctcg 421 aggctctact gtgtgcagag acgggggaga agaagattga gcTGAAGGAG GAGGAGACCA 481 TTATGGACTG TCAGAAACAG CAGTTGCTGG AGTTTCCGCA TGACCTCGAG GTGGAAGACT 541 TGGAGGATGA CATTCCCAGG AGGAAGAACA GGGCCAAAGG AAAGGCATAT GGCATCGGGG 601 GTCTCCGGAA ACGCCAGGAC ACCGCTTCCC TGGAGGACCG AGACAAGCCG TATGTCTGTG 661 ATAGTGAGTC CTTCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 721 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 781 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTATCTACGG GGGAGTCACA 841 GTCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt