Transcript: Mouse XM_006540034.3

PREDICTED: Mus musculus D4, zinc and double PHD fingers family 1 (Dpf1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dpf1 (29861)
Length:
3258
CDS:
940..2217

Additional Resources:

NCBI RefSeq record:
XM_006540034.3
NBCI Gene record:
Dpf1 (29861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423226 TATACAAAGAGTCCTATAAAG pLKO_005 2579 3UTR 100% 13.200 18.480 N Dpf1 n/a
2 TRCN0000082139 CCTGCGAGTACAAGATCGATT pLKO.1 1304 CDS 100% 4.950 6.930 N Dpf1 n/a
3 TRCN0000426673 GCGATCGAGGTTACCACATGT pLKO_005 2090 CDS 100% 4.950 6.930 N Dpf1 n/a
4 TRCN0000433398 TTGCTGGAGTTTCCGCATGAT pLKO_005 1459 CDS 100% 4.950 6.930 N Dpf1 n/a
5 TRCN0000082140 GTGTTTACAGTTCACGGTGAA pLKO.1 1932 CDS 100% 4.050 5.670 N Dpf1 n/a
6 TRCN0000231954 GTTGCTGGAGTTTCCGCATGA pLKO_005 1458 CDS 100% 4.050 5.670 N DPF1 n/a
7 TRCN0000436034 ATCTGTGGGAAGAGATATAAG pLKO_005 1618 CDS 100% 13.200 9.240 N Dpf1 n/a
8 TRCN0000082138 CCCTCTTCATCCCTTGACAAA pLKO.1 2411 3UTR 100% 4.950 3.465 N Dpf1 n/a
9 TRCN0000082141 GAGGTAGAAGACTTGGAGGAA pLKO.1 1483 CDS 100% 2.640 1.848 N Dpf1 n/a
10 TRCN0000082142 GCCCTGCCTTTCCACCGGAAA pLKO.1 1717 CDS 100% 0.000 0.000 N Dpf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473291 GAGTCACCCTCAAGGGCGTCCCCA pLX_317 28.8% 84.7% 88.9% V5 (many diffs) n/a
2 ccsbBroadEn_11259 pDONR223 100% 43.6% 45.4% None (many diffs) n/a
3 ccsbBroad304_11259 pLX_304 0% 43.6% 45.4% V5 (many diffs) n/a
4 TRCN0000477599 CTATCTACGGGGGAGTCACAGTCC pLX_317 35.4% 43.6% 45.4% V5 (many diffs) n/a
Download CSV