Construct: ORF TRCN0000477643
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014411.1_s317c1
- Derived from:
- ccsbBroadEn_04741
- DNA Barcode:
- TCCATTCAATAGGCGCCGCAAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OR4X2 (119764)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477643
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 119764 | OR4X2 | olfactory receptor family 4... | NM_001004727.1 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 978
- ORF length:
- 909
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gactgaattc atttttctgg tactttctcc caaccaggag gtgcagaggg 121 tttgctttgt gatatttctg ttcttgtaca cagcaattgt gctggggaat ttcctcattg 181 tgctcactgt catgaccagc agaagccttg gttcccccat gtacttcttc ctcagctacc 241 tctccttcat ggagatctgc tactcctccg ctacagcccc caaactcatc tcagatctgc 301 tggctgaaag gaaagtcata tcttggtggg gctgcatggc acagcttttc ttcttgcact 361 tctttggtgg cactgagatt ttcctgctca ctgtgatggc ctatgaccac tatgtggcca 421 tctgcaagcc cctcagctac accaccatca tgaactggca ggtgtgtact gtccttgtag 481 gaatagcatg ggtgggaggc ttcatgcatt cctttgcaca aatccttctc atcttccacc 541 tgctcttctg tggccccaat gtgatcaatc actatttctg tgacctagtt ccccttctca 601 aacttgcctg cTCTGACACC TTCCTCATTG GTCTGCTGAT TGTTGCCAAT GGAGGCACCC 661 TGTCTGTGAT CAGTTTTGGG GTCCTCTTAG CATCCTATAT GGTCATCTTG CTCCATCTGA 721 GAACCTGGAG CTCTGAAGGG TGGTGCAAAG CCCTCTCCAC CTGTGGGTCC CATTTCGCTG 781 TGGTTATCTT GTTCTTTGGG CCCTGCGTCT TCAACTCTCT GAGGCCTTCT ACCACTCTGC 841 CCATAGACAA GATGGTGGCT GTGTTCTACA CAGTGATAAC CGCGATCCTG AACCCTGTCA 901 TCTACTCTCT GAGAAATGCT GAAATGAGGA AGGCCATGAA GAGGCTGTGG ATTAGGACAT 961 TGAGACTAAA TGAGAAATTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1021 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1081 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATCCATTC AATAGGCGCC 1141 GCAAAGCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt