Transcript: Human NM_001004727.1

Homo sapiens olfactory receptor family 4 subfamily X member 2 (gene/pseudogene) (OR4X2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
OR4X2 (119764)
Length:
912
CDS:
1..912

Additional Resources:

NCBI RefSeq record:
NM_001004727.1
NBCI Gene record:
OR4X2 (119764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204677 GTCCCATTTCGCTGTGGTTAT pLKO.1 699 CDS 100% 10.800 7.560 N OR4X2 n/a
2 TRCN0000220945 CTCATTGGTCTGCTGATTGTT pLKO.1 556 CDS 100% 5.625 3.938 N Olfr1506 n/a
3 TRCN0000189006 GCAGAGGGTTTGCTTTGTGAT pLKO.1 45 CDS 100% 4.950 3.465 N OR4X2 n/a
4 TRCN0000184879 CCAATGTGATCAATCACTATT pLKO.1 488 CDS 100% 13.200 7.920 N OR4X2 n/a
5 TRCN0000234054 TCTTTGGTGGCACTGAGATTT pLKO_005 293 CDS 100% 13.200 6.600 Y Olfr1269 n/a
6 TRCN0000187100 CCCAATGTGATCAATCACTAT pLKO.1 487 CDS 100% 4.950 2.475 Y OR4X2 n/a
7 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 149 CDS 100% 4.950 2.475 Y OR10A2 n/a
8 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 148 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04741 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04741 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477643 TCCATTCAATAGGCGCCGCAAAGC pLX_317 40.4% 100% 100% V5 n/a
Download CSV