Construct: ORF TRCN0000477668
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012807.1_s317c1
- Derived from:
- ccsbBroadEn_06341
- DNA Barcode:
- TACAACGGCCTTCGATCGAGGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GUCA2B (2981)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477668
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2981 | GUCA2B | guanylate cyclase activator 2B | NM_007102.3 | 99.7% | 100% | 18A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 405
- ORF length:
- 336
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggctgcagg gctgcgtcag ggctcctgcc aggagtggcc gtggtcctcc 121 tgctgctgct gcagagcaca cagtcagtct acatccagta ccaaggcttc cgggtccagc 181 tggaatccat gaagaagctg agtgacctgg aggcacagtg ggcacccagc ccccgcctgc 241 aggcccagag cctcctgccc gccgtgtgcc accaccctgc tctgcctcag gaccttcagc 301 ctgtctgcgc ctcgcaggag gcttccagca tcttcaagac cctgaggacc atcgctaacg 361 acgacTGTGA GCTGTGTGTG AACGTTGCGT GTACCGGCTG CCTCTTGCCA ACTTTCTTGT 421 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 481 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 541 GAAAGGACGA TACAACGGCC TTCGATCGAG GCAGACGCGT TAAGTCgaca atcaacctct 601 ggattacaaa atttgtgaaa gatt