Construct: ORF TRCN0000477845
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008423.1_s317c1
- Derived from:
- ccsbBroadEn_05894
- DNA Barcode:
- GTTAGATTATGTAACATGATTATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BLVRA (644)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477845
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 644 | BLVRA | biliverdin reductase A | NM_000712.4 | 99.8% | 100% | 861A>G |
| 2 | human | 644 | BLVRA | biliverdin reductase A | NM_001253823.1 | 99.8% | 100% | 861A>G |
| 3 | human | 644 | BLVRA | biliverdin reductase A | XM_011515474.3 | 99.8% | 100% | 861A>G |
| 4 | human | 644 | BLVRA | biliverdin reductase A | XM_017012520.2 | 99.8% | 100% | 861A>G |
| 5 | human | 644 | BLVRA | biliverdin reductase A | XM_024446867.1 | 99.8% | 100% | 861A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 954
- ORF length:
- 888
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgcagagccc gagaggaagt ttggcgtggt ggtggttggt gttggccgag 121 ccggctccgt gcggatgagg gacttgcgga atccacaccc ttcctcagcg ttcctgaacc 181 tgattggctt cgtgtcgaga agggagctcg ggagcattga tggagtccag cagatttctt 241 tggaggatgc tctttccagc caagaggtgg aggtcgccta tatctgcagt gagagctcca 301 gccatgagga ctacatcagg cagttcctta atgctggcaa gcacgtcctt gtggaatacc 361 ccatgacact gtcattggcg gccgctcagg aactgtggga gctggctgag cagaaaggaa 421 aagtcttgca cgaggagcat gttgaactct tgatggagga attcgctttc ctgaaaaaag 481 aagtggtggg gaaagacctg ctgaaagggt cgcTCCTCTT CACAGCTGGC CCGTTGGAAG 541 AAGAGCGGTT TGGCTTCCCT GCATTCAGCG GCATCTCTCG CCTGACCTGG CTGGTCTCCC 601 TCTTTGGGGA GCTTTCTCTT GTGTCTGCCA CTTTGGAAGA GCGAAAGGAA GATCAGTATA 661 TGAAAATGAC AGTGTGTCTG GAGACAGAGA AGAAAAGTCC ACTGTCATGG ATTGAAGAAA 721 AAGGACCTGG TCTAAAACGA AACAGATATT TAAGCTTCCA TTTCAAGTCT GGGTCCTTGG 781 AGAATGTGCC AAATGTAGGA GTGAATAAGA ACATATTTCT GAAAGATCAA AATATATTTG 841 TCCAGAAACT CTTGGGCCAG TTCTCTGAGA AGGAACTGGC TGCTGAAAAG AAACGCATCC 901 TGCACTGCCT GGGGCTTGCA GAAGAGATCC AGAAATATTG CTGTTCAAGG AAGTACCCAA 961 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1021 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1081 TATCTTGTGG AAAGGACGAG TTAGATTATG TAACATGATT ATCACGCGTT AAGTCgacaa 1141 tcaacctctg gattacaaaa tttgtgaaag att