Transcript: Human XM_017012520.2

PREDICTED: Homo sapiens biliverdin reductase A (BLVRA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BLVRA (644)
Length:
1121
CDS:
124..1014

Additional Resources:

NCBI RefSeq record:
XM_017012520.2
NBCI Gene record:
BLVRA (644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046390 GCGAAAGGAAGATCAGTATAT pLKO.1 699 CDS 100% 13.200 18.480 N BLVRA n/a
2 TRCN0000307023 GCGAAAGGAAGATCAGTATAT pLKO_005 699 CDS 100% 13.200 18.480 N BLVRA n/a
3 TRCN0000046392 GTGCCAAATGTAGGAGTGAAT pLKO.1 844 CDS 100% 4.950 3.960 N BLVRA n/a
4 TRCN0000289081 GTGCCAAATGTAGGAGTGAAT pLKO_005 844 CDS 100% 4.950 3.960 N BLVRA n/a
5 TRCN0000046388 GCAGAAGAAATCCAGAAATAT pLKO.1 976 CDS 100% 15.000 10.500 N BLVRA n/a
6 TRCN0000296159 AGAGGTGGAGGTCGCCTATAT pLKO_005 321 CDS 100% 13.200 9.240 N BLVRA n/a
7 TRCN0000296106 CAGCGTTCCTGAACCTGATTG pLKO_005 224 CDS 100% 10.800 7.560 N BLVRA n/a
8 TRCN0000046391 GCAGTTCCTTAATGCTGGCAA pLKO.1 378 CDS 100% 2.640 1.848 N BLVRA n/a
9 TRCN0000289027 GCAGTTCCTTAATGCTGGCAA pLKO_005 378 CDS 100% 2.640 1.848 N BLVRA n/a
10 TRCN0000046389 CCATTTCAAGTCTGGGTCCTT pLKO.1 816 CDS 100% 2.640 1.584 N BLVRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05894 pDONR223 100% 99.8% 100% None 861A>G n/a
2 ccsbBroad304_05894 pLX_304 0% 99.8% 100% V5 861A>G n/a
3 TRCN0000477845 GTTAGATTATGTAACATGATTATC pLX_317 49.6% 99.8% 100% V5 861A>G n/a
4 ccsbBroadEn_05895 pDONR223 100% 99.7% 99.3% None 7G>A;362T>C n/a
5 ccsbBroad304_05895 pLX_304 0% 99.7% 99.3% V5 7G>A;362T>C n/a
6 TRCN0000467172 GCCGGCACTCAGCGGTCTAGCTGC pLX_317 39.2% 99.7% 99.3% V5 7G>A;362T>C n/a
Download CSV