Construct: ORF TRCN0000477854
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006915.1_s317c1
- Derived from:
- ccsbBroadEn_14193
- DNA Barcode:
- GTAGCTACGCCCATCTAAAGGCCA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OGFOD1 (55239)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477854
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_018233.4 | 99.9% | 99% | 1611delA |
2 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324357.2 | 99.7% | 98.8% | 153_154insGAA;1608delA |
3 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324363.2 | 92.9% | 92% | 786_787ins114;1497delA |
4 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324358.1 | 89.7% | 88.9% | 0_1ins165;1446delA |
5 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324361.1 | 89.7% | 88.9% | 0_1ins165;1446delA |
6 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324359.1 | 82% | 80.6% | (many diffs) |
7 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324360.2 | 82% | 80.6% | (many diffs) |
8 | human | 55239 | OGFOD1 | 2-oxoglutarate and iron dep... | NM_001324362.1 | 74.1% | 73.2% | 0_1ins420;1191delA |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1692
- ORF length:
- 1626
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgggaagcgg ccagcggagc ccggcccagc ccgggtggga aaaaagggaa 121 agaaggaggt gatggcggag ttttcggacg ctgttacgga agaaaccttg aaaaagcagg 181 tggctgaggc ctggagccgc aggacgccgt tcagtcacga agtcattgtc atggacatgg 241 acccttttct tcactgtgtg atcccaaact tcatccaaag ccaagacttc ttagaagggc 301 ttcagaagga actgatgaac ttggacttcc atgagaagta taatgattta tataagttcc 361 agcagtctga tgatttgaag aagagaagag agcctcacat ctccacttta aggaaaattc 421 tgtttgaaga tttccggtcc tggctttctg atatttctaa aattgacctg gaatcaacca 481 ttgacatgtc ctgtgctaaa tatgaattca ctgatgccct gctgtgccat gatgatgagc 541 tggaagggcg ccggattgcc ttcatcctgt acctggttcc tccctgggac aggagcatgg 601 gtggtaccct ggacctgtac agcattgatg aacactttca gccgaagcag attgtcaagt 661 ctcttatccc ttcgtggaac aaactggttt tctttgaagt atctcctgtg tcctttcacc 721 aggtgtctga agtgctgtct gaagaaaagt cacgtttgtc tataagtggc tggtttcatg 781 gtccatcatt gactcggcct cccaactact ttgaaccccc catacctcgg agccctcaca 841 tcccacaaga tcatgagatt ttgtatgatt ggatcaaccc tacttatctg gacatggatt 901 accaagttca aattcaagaa gagtttgaag aaagttctga aattctcctg aaggagtttc 961 ttaagcctga gaaattcacg aaagtctgtg aggccttgga gcatggacat gtggaatgga 1021 gcagccgagg tccccctaac aaaaggtttt atgagaaagc tgaggagagt aagcttcctg 1081 agatattgaa ggagtgcatg aagttatttc gctctgaggc actattcttg ctgctctcca 1141 acttcacagg cctgaagctt catttcttgg ccccttcgga agaagatgag atgaatgata 1201 aaaaagaggc agaaaccact gatatcactg aagaagggac tagccatagt cctcctgagc 1261 cagagaataa tcagatggcc atcagcaaca acagccaaca gagcaatgag cagacagacc 1321 cagagccaga ggaaaatgaa acaaagaaag aatcaagtgt tcccatgtgc caagggGAAC 1381 TGAGGCATTG GAAGACCGGT CACTACACTT TAATTCATGA CCATAGCAAG GCTGAATTTG 1441 CCCTAGACTT AATTCTGTAC TGTGGCTGTG AAGGCTGGGA GCCAGAATAT GGCGGTTTTA 1501 CTTCTTACAT TGCCAAAGGT GAAGATGAAG AGCTGCTAAC AGTGAATCCA GAAAGCAATT 1561 CTTTGGCATT GGTCTACAGA GACAGAGAGA CTCTGAAATT TGTCAAGCAT ATTAACCACC 1621 GAAGCCTGGA ACAAAAGAAA ACCTTCCCAA ACAGAACAGG TTTCTGGGAC TTTTCTTCAT 1681 CTATTATGAA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA 1741 CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC 1801 GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGTAG CTACGCCCAT CTAAAGGCCA 1861 ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt