Transcript: Human NM_001324361.1

Homo sapiens 2-oxoglutarate and iron dependent oxygenase domain containing 1 (OGFOD1), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
OGFOD1 (55239)
Length:
2809
CDS:
56..1519

Additional Resources:

NCBI RefSeq record:
NM_001324361.1
NBCI Gene record:
OGFOD1 (55239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038908 CGGTCACTACACTTTAATTCA pLKO.1 1222 CDS 100% 5.625 4.500 N OGFOD1 n/a
2 TRCN0000418823 GAATTTGCCCTAGACTTAATT pLKO_005 1259 CDS 100% 15.000 10.500 N OGFOD1 n/a
3 TRCN0000414378 TGACATGTCCTGTGCTAAATA pLKO_005 307 CDS 100% 15.000 10.500 N OGFOD1 n/a
4 TRCN0000038905 GCAGATTGTCAAGTCTCTTAT pLKO.1 472 CDS 100% 13.200 9.240 N OGFOD1 n/a
5 TRCN0000425081 TATGCAATTCAGTGGATTAAG pLKO_005 1861 3UTR 100% 13.200 9.240 N OGFOD1 n/a
6 TRCN0000038904 GCTGGTTTCATGGTCCATCAT pLKO.1 594 CDS 100% 4.950 3.465 N OGFOD1 n/a
7 TRCN0000038906 CCTACTTATCTGGACATGGAT pLKO.1 704 CDS 100% 3.000 2.100 N OGFOD1 n/a
8 TRCN0000039216 CCAAACTTCATCCAAAGCCAA pLKO.1 89 CDS 100% 2.640 1.848 N Ogfod1 n/a
9 TRCN0000038907 CCTTCCCAAACAGAACAGGTT pLKO.1 1467 CDS 100% 2.640 1.848 N OGFOD1 n/a
10 TRCN0000164177 CAGCCTGACAAACATGGAGAA pLKO.1 2247 3UTR 100% 4.050 2.025 Y RINL n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2182 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2183 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14193 pDONR223 100% 89.7% 88.9% None 0_1ins165;1446delA n/a
2 ccsbBroad304_14193 pLX_304 0% 89.7% 88.9% V5 (not translated due to frame shift) 0_1ins165;1446delA n/a
3 TRCN0000477854 GTAGCTACGCCCATCTAAAGGCCA pLX_317 19.7% 89.7% 88.9% V5 (not translated due to frame shift) 0_1ins165;1446delA n/a
Download CSV