Construct: ORF TRCN0000478226
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016178.1_s317c1
- Derived from:
- ccsbBroadEn_07277
- DNA Barcode:
- ACTTAACATGACTGTATCAGCAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RTCA (8634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478226
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8634 | RTCA | RNA 3'-terminal phosphate c... | NM_001130841.1 | 99.9% | 99.7% | 101T>C |
| 2 | human | 8634 | RTCA | RNA 3'-terminal phosphate c... | NM_003729.3 | 96.4% | 96.3% | 101T>C;144_145ins39 |
| 3 | human | 8634 | RTCA | RNA 3'-terminal phosphate c... | XM_005271298.5 | 81.5% | 81.5% | 0_1ins210 |
| 4 | human | 8634 | RTCA | RNA 3'-terminal phosphate c... | XM_005271299.4 | 81.5% | 81.5% | 0_1ins210 |
| 5 | human | 8634 | RTCA | RNA 3'-terminal phosphate c... | XM_017002669.1 | 81.5% | 81.5% | 0_1ins210 |
| 6 | mouse | 66368 | Rtca | RNA 3'-terminal phosphate c... | NM_025517.3 | 82.7% | 87.3% | (many diffs) |
| 7 | mouse | 66368 | Rtca | RNA 3'-terminal phosphate c... | XM_006501883.1 | 69.8% | 73.3% | (many diffs) |
| 8 | mouse | 66368 | Rtca | RNA 3'-terminal phosphate c... | XM_006501884.2 | 58.1% | 61.7% | (many diffs) |
| 9 | mouse | 66368 | Rtca | RNA 3'-terminal phosphate c... | XR_001783733.1 | 55% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1203
- ORF length:
- 1137
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggggccgcgg gtggaggtcg atggcagcat catggaaggg ggcggccaga 121 tcctgagagt ctctacggcc ttgagctgtc tcctaggcct cccctcgcgg gtgcagaaga 181 tccgagccgg ccggagcacg ccaggcctga gttctggagg ctggaagtcc aagatcaagg 241 tcctgacaag gcctcaacat ttatctggac tggaaatgat tcgagatttg tgtgatgggc 301 aactggaggg ggcagaaatt ggctcaacag aaataacctt tacaccagag aagatcaaag 361 gtggaatcca cacagcagat accaagacag cagggagtgt gtgcctcttg atgcaggtct 421 caatgccgtg tgttctcttt gctgcttctc catcagaact tcatttgaaa ggtggaacta 481 atgctgaaat ggcaccacag atcgattata cagtgatggt cttcaagcca attgttgaaa 541 aatttggttt catatttaat tgtgacatta aaacaagggg atattaccca aaagggggtg 601 gtgaagtgat tgttcgaatg tcaccagtta aacaattgaa ccctataaat ttaactgagc 661 gtggctgtgt gactaagata tatggaagag ctttcgttgc tggtgttttg ccatttaaag 721 tagcaaaaga tatggcagcg gcagcagtta gatgcatcag aaaggagatc cgggatttgt 781 atgttaacat ccagcctgtt caagaaccta aagaccaagc atttggcaat ggaaatggaa 841 taataattat tgctgagacc tccactggct gtttgtttgc tggatcatcg cttggtaaac 901 gaggtgtaaa tgcagacaaa gttggaattg aagctgccga aatgctatta gcaaaTCTTA 961 GACATGGTGG TACTGTGGAT GAGTATCTGC AAGACCAGCT GATTGTTTTC ATGGCATTAG 1021 CCAATGGAGT TTCCAGAATA AAAACAGGAC CAGTTACACT CCATACGCAA ACCGCGATAC 1081 ATTTTGCTGA ACAAATAGCA AAGGCTAAAT TTATTGTGAA GAAATCAGAA GATGAAGAAG 1141 ACGCCGCTAA AGATACTTAT ATTATTGAAT GCCAAGGAAT TGGGATGACA AATCCAAATC 1201 TATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1261 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1321 GGCTTTATAT ATCTTGTGGA AAGGACGAAC TTAACATGAC TGTATCAGCA AGACGCGTTA 1381 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt