Transcript: Mouse XM_006501883.1

PREDICTED: Mus musculus RNA 3'-terminal phosphate cyclase (Rtca), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rtca (66368)
Length:
1425
CDS:
222..1151

Additional Resources:

NCBI RefSeq record:
XM_006501883.1
NBCI Gene record:
Rtca (66368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102354 GCCAAATTTACCGTGAAGAAA pLKO.1 1050 CDS 100% 5.625 4.500 N Rtca n/a
2 TRCN0000308806 GCCAAATTTACCGTGAAGAAA pLKO_005 1050 CDS 100% 5.625 4.500 N Rtca n/a
3 TRCN0000102352 CGTCATCGAGTGTGAAGGAAT pLKO.1 1106 CDS 100% 4.950 3.960 N Rtca n/a
4 TRCN0000308889 CGTCATCGAGTGTGAAGGAAT pLKO_005 1106 CDS 100% 4.950 3.960 N Rtca n/a
5 TRCN0000102353 CCAAGATTTATGGGAGAGCTT pLKO.1 619 CDS 100% 2.640 2.112 N Rtca n/a
6 TRCN0000308808 CCAAGATTTATGGGAGAGCTT pLKO_005 619 CDS 100% 2.640 2.112 N Rtca n/a
7 TRCN0000102351 CCAATGGAATTTCCAGAATAA pLKO.1 967 CDS 100% 13.200 9.240 N Rtca n/a
8 TRCN0000308888 CCAATGGAATTTCCAGAATAA pLKO_005 967 CDS 100% 13.200 9.240 N Rtca n/a
9 TRCN0000102350 GCACTGTCAGTTGCTGAGAAT pLKO.1 1265 3UTR 100% 4.950 2.970 N Rtca n/a
10 TRCN0000308807 GCACTGTCAGTTGCTGAGAAT pLKO_005 1265 3UTR 100% 4.950 2.970 N Rtca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07277 pDONR223 100% 69.8% 73.3% None (many diffs) n/a
2 ccsbBroad304_07277 pLX_304 0% 69.8% 73.3% V5 (many diffs) n/a
3 TRCN0000478226 ACTTAACATGACTGTATCAGCAAG pLX_317 22.2% 69.8% 73.3% V5 (many diffs) n/a
Download CSV