Construct: ORF TRCN0000478362
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016135.1_s317c1
- Derived from:
- ccsbBroadEn_03455
- DNA Barcode:
- CTTTCCGCAACCGCGGAGGCGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KLHDC4 (54758)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478362
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54758 | KLHDC4 | kelch domain containing 4 | NM_017566.4 | 100% | 100% | |
| 2 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_005255994.4 | 100% | 100% | |
| 3 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_017023344.2 | 100% | 100% | |
| 4 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_006721201.2 | 99% | 98.8% | 507_521del |
| 5 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_006721202.2 | 99% | 98.8% | 507_521del |
| 6 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_006721203.3 | 99% | 98.8% | 507_521del |
| 7 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_006721204.4 | 99% | 98.8% | 507_521del |
| 8 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_024450317.1 | 99% | 98.8% | 507_521del |
| 9 | human | 54758 | KLHDC4 | kelch domain containing 4 | NM_001184856.2 | 94% | 94% | 506_507ins93 |
| 10 | human | 54758 | KLHDC4 | kelch domain containing 4 | NM_001184854.2 | 89% | 89% | 99_100ins171 |
| 11 | human | 54758 | KLHDC4 | kelch domain containing 4 | NR_147833.2 | 77.5% | 1_96del;931_1021del;1748_2012del | |
| 12 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751928.2 | 76.9% | (many diffs) | |
| 13 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_933342.3 | 76.6% | (many diffs) | |
| 14 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751932.2 | 74% | (many diffs) | |
| 15 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751937.1 | 72.2% | 1_42del;310_314delAAAGT;1608_2158del | |
| 16 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751929.2 | 71.2% | (many diffs) | |
| 17 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751927.2 | 70.5% | 1_101del;1662_2212del | |
| 18 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751926.2 | 70.1% | 1_101del;608_622del;1677_2224del | |
| 19 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_429719.3 | 70% | 1_101del;608_622del;1677_2227del | |
| 20 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751938.1 | 69.5% | 1_98del;345_346ins23;1636_2186del | |
| 21 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751933.2 | 68.3% | (many diffs) | |
| 22 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751936.1 | 68.1% | 1_67del;165_274del;1738_2288del | |
| 23 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751939.1 | 66.9% | 1_101del;292_293ins79;1583_2133del | |
| 24 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751930.2 | 66.3% | 1_101del;607_608ins93;1569_2119del | |
| 25 | human | 54758 | KLHDC4 | kelch domain containing 4 | NM_001351937.2 | 65.1% | 65.1% | 0_1ins543 |
| 26 | human | 54758 | KLHDC4 | kelch domain containing 4 | NM_001351938.2 | 65.1% | 65.1% | 0_1ins543 |
| 27 | human | 54758 | KLHDC4 | kelch domain containing 4 | XM_024450318.1 | 65.1% | 65.1% | 0_1ins543 |
| 28 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751944.2 | 64.7% | (many diffs) | |
| 29 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751941.1 | 64.5% | (many diffs) | |
| 30 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751935.1 | 63.4% | 1_71del;169_443del;1907_2457del | |
| 31 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751942.1 | 63.4% | (many diffs) | |
| 32 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_933341.3 | 60.7% | 1_101del;608_622del;1677_2569del | |
| 33 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751940.1 | 60.2% | (many diffs) | |
| 34 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_002957825.1 | 57.2% | (many diffs) | |
| 35 | human | 54758 | KLHDC4 | kelch domain containing 4 | XR_001751943.1 | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1626
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg caagaagggc aagaaggaga agaagggccg cggcgcggag aagacggccg 121 ccaagatgga gaagaaggtg tctaagcgct cgcggaagga ggaggaagac ctggaagcgc 181 tcatagccca tttccagaca ctcgatgcca agaggactca gactgtggaa cttccgtgcc 241 ccccaccctc accaaggtta aatgcctccc tctcggttca tcctgagaaa gatgagttaa 301 tcctttttgg aggtgaatat ttcaacggcc aaaaaacttt tttgtataac gagctctatg 361 tctacaatac cagaaaggac acctggacca aagttgacat ccccagtcca cctccgaggc 421 gctgtgctca ccaggcggtg gtagtgcctc aaggtggcgg acagctgtgg gtctttggag 481 gggagtttgc ctctcccaac ggagagcagt tctaccacta caaggatctc tgggtcctgc 541 atttggccac caagacctgg gaacaagtca aatcaacagg cggtccttcg ggtcggagtg 601 gacatcggat ggtggcctgg aagagacaat tgatcctgtt tggtggcttc catgaaagta 661 cacgggatta catctactac aacgacgtgt atgcctttaa tctggacacc ttcacatgga 721 gcaagctgtc cccgtcaggg acggggccca cacccagatc aggctgccag atgtccgtca 781 ctccccaggg cggcatcgtc gtctatgggg gctactcgaa acagagagtt aagaaagacg 841 tggacaaggg cacacggcac tcagacatgt tcctgctgaa gccagaggac ggaagagaag 901 acaagtgggt ttggactcgg atgaaccctt cgggggtcaa gcccacccca cggtctggct 961 tttccgtggc catggccccg aatcaccaga cactgttctt cgggggtgtc tgtgacgagg 1021 aagaggagga gagcctgtcg ggcgagttct tcaacgatct gtacttctac gacgccacca 1081 ggaaccgttg gtttgaggga cagctgaagg gacccaagtc tgaaaagaag aaacgcaggc 1141 ggggcagaaa agaggagccc gaaggtggta gcaggccggc gtgtggggga gctggcaccc 1201 aggggcctgt gcagctggtc aaggaggtgg tggccgagga tggcaccgtg gtcaccatta 1261 agcaggtgct caccgcgcca ggctcggcgg ggcagccccg gtctgaggac gaagacagcc 1321 ttgaggaggc cggcagcccc gcaccTGGGC CGTGTCCACG CTCCAACGCC ATGCTGGCTG 1381 TGAAGCATGG GGTGCTCTAC GTCTATGGGG GCATGTTTGA GGCCGGCGAC CGCCAGGTCA 1441 CCCTCAGCGA CCTGCACTGC CTGGACCTGC ACAGGATGGA GGCGTGGAAG GCCTTGGTGG 1501 AGATGGACCC AGAAACTCAG GAGTGGCTGG AGGAGACGGA CTCGGAAGAG GACAGTGAGG 1561 AGGTTGAGGG CGCCGAGGGT GGGGTCGACG ACGAAGACAG CGGAGAGGAG AGCGGTGCGG 1621 AGGACTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1681 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1741 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTTTCCGCA ACCGCGGAGG CGTTTACGCG 1801 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt