Transcript: Human XR_001751935.1

PREDICTED: Homo sapiens kelch domain containing 4 (KLHDC4), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHDC4 (54758)
Length:
2457
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751935.1
NBCI Gene record:
KLHDC4 (54758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297111 TCTACTACAACGACGTGTATG pLKO_005 954 3UTR 100% 10.800 15.120 N KLHDC4 n/a
2 TRCN0000134622 GTTCTTCAACGATCTGTACTT pLKO.1 1327 3UTR 100% 4.950 6.930 N KLHDC4 n/a
3 TRCN0000277640 GGAAGCGCTCATAGCCCATTT pLKO_005 454 3UTR 100% 10.800 8.640 N KLHDC4 n/a
4 TRCN0000277699 ACGAGCTCTATGTCTACAATA pLKO_005 630 3UTR 100% 13.200 9.240 N KLHDC4 n/a
5 TRCN0000138216 CACCTGGACCAAAGTTGACAT pLKO.1 661 3UTR 100% 4.950 3.465 N KLHDC4 n/a
6 TRCN0000135133 CGAGTTCTTCAACGATCTGTA pLKO.1 1324 3UTR 100% 4.950 3.465 N KLHDC4 n/a
7 TRCN0000135711 GATGGAGAAGAAGGTGTCTAA pLKO.1 131 3UTR 100% 4.950 3.465 N KLHDC4 n/a
8 TRCN0000135995 GAAGAGAAGACAAGTGGGTTT pLKO.1 1173 3UTR 100% 4.050 2.835 N KLHDC4 n/a
9 TRCN0000286009 GAAGAGAAGACAAGTGGGTTT pLKO_005 1173 3UTR 100% 4.050 2.835 N KLHDC4 n/a
10 TRCN0000277698 GCCGTGTTGAGTGAAGCTCTT pLKO_005 1968 3UTR 100% 4.050 2.835 N KLHDC4 n/a
11 TRCN0000138361 CAAGGTTAAATGCCTCCCTCT pLKO.1 534 3UTR 100% 2.160 1.512 N KLHDC4 n/a
12 TRCN0000133687 GAAGAGACAATTGATCCTGTT pLKO.1 901 3UTR 100% 4.050 2.430 N KLHDC4 n/a
13 TRCN0000133711 GTGAATATTTCAACGGCCAAA pLKO.1 594 3UTR 100% 4.050 2.430 N KLHDC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03455 pDONR223 100% 63.4% None 1_71del;169_443del;1907_2457del n/a
2 ccsbBroad304_03455 pLX_304 0% 63.4% V5 1_71del;169_443del;1907_2457del n/a
3 TRCN0000478362 CTTTCCGCAACCGCGGAGGCGTTT pLX_317 18.4% 63.4% V5 1_71del;169_443del;1907_2457del n/a
4 ccsbBroadEn_15868 pDONR223 0% 56.5% None 1_71del;171_616del;1907_2457del n/a
5 ccsbBroad304_15868 pLX_304 0% 56.5% V5 1_71del;171_616del;1907_2457del n/a
6 TRCN0000467443 CTTTCTTCACCATTTACAATCGGG pLX_317 35% 56.5% V5 1_71del;171_616del;1907_2457del n/a
Download CSV