Construct: ORF TRCN0000478450
Construct Description:
- Construct Type:
 - ORF
 - Other Identifiers:
 - ORF009253.2_s317c1
 - Derived from:
 - ccsbBroadEn_13378
 - DNA Barcode:
 - AGGTGGACGCTCAACCGACCGCGG
 - Epitope Tag:
 - V5
 - Notes:
 - No stop codon in insert
 
Originally Annotated References:
- Gene:
 - TTC21A (199223)
 
Vector Information:
- Vector Backbone:
 - pLX_317
 - Pol II Cassette 1:
 - SV40-PuroR
 - Pol II Cassette 2:
 - EF1a-TRCN0000478450
 - Selection Marker:
 - PuroR
 - Visible Reporter:
 - n/a
 - Epitope Tag:
 - n/a
 
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows:  total nt. matches ---------------------------------- aligned length (incl. gaps)  | 
              Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows:  total aa. matches ---------------------------------- aligned length (incl. gaps)  | 
              Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_011533449.2 | 37% | 36.5% | (many diffs) | 
| 2 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_024453382.1 | 32.1% | 31.6% | (many diffs) | 
| 3 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_017005843.2 | 23% | 22.6% | (many diffs) | 
| 4 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_005264926.5 | 22.8% | 22.4% | (many diffs) | 
| 5 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XR_001740050.2 | 22.1% | (many diffs) | |
| 6 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NM_145755.2 | 21.4% | 21.1% | (many diffs) | 
| 7 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_011533447.3 | 21.4% | 20.9% | (many diffs) | 
| 8 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NM_001366899.1 | 21.4% | 21.1% | (many diffs) | 
| 9 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_005264924.5 | 21.3% | 21% | (many diffs) | 
| 10 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NR_159495.1 | 21.1% | (many diffs) | |
| 11 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NM_001366900.1 | 21% | 20.6% | (many diffs) | 
| 12 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_006713011.4 | 20.9% | 20.5% | (many diffs) | 
| 13 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_005264922.5 | 20.8% | 20.4% | (many diffs) | 
| 14 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_005264921.5 | 20.7% | 20.4% | (many diffs) | 
| 15 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NR_159494.1 | 20.3% | (many diffs) | |
| 16 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NR_159496.1 | 19.9% | (many diffs) | |
| 17 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XR_427257.3 | 19.9% | (many diffs) | |
| 18 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XR_427256.3 | 19.8% | (many diffs) | |
| 19 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XR_001740049.2 | 19.5% | (many diffs) | |
| 20 | human | 199223 | TTC21A | tetratricopeptide repeat do... | NM_001105513.2 | 17.9% | 17.5% | (many diffs) | 
| 21 | human | 199223 | TTC21A | tetratricopeptide repeat do... | XM_005264925.5 | 17.7% | 17.3% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
 - 66
 - ORF end:
 - 927
 - ORF length:
 - 861
 - Sequence:
 - 
          
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cagcaatgac tcctccctta tggctgggat catttactat agccaggaaa 121 agtacttcca ccatgtgcag caggctgcag ctgtgggcct ggaaaaattc agcaatgacc 181 ctgtgttgaa gttctttaaa gcctatggag tcctcaaaga agagcacatc caggatgcca 241 tcagtgacct ggaaagcatc aggcatcacc cagacgtgtc cctgtgctcc accatggccc 301 tcatttatgc tcacaaaaga tgtgaaatca ttgaccaaga agcaattcag gagcttgagt 361 acagcctgaa ggaaatacgc aagacactca gtgggactgc actgtactat gctggccttt 421 tcctctggct cataggccgc catgacaagg ccaaagagta cattgaccgc atgctgaaga 481 tttctagagg cttcagagag gcctatgtgc tcagaggctg ggtggacctg acctcagaca 541 agccccacac tgcgaagaaa gccattgagt acctggaaca aggaattcag gacacCAAAG 601 ATGTGCTGGG GCTGATGGGA AAGGCAATGT ACTTCATGAT GCAGCAGAAC TACTCAGAGG 661 CCCTGGAGGT GGTGAACCAG ATCACTGTGA CTTCAGGGAG CTTCCTGCCA GCCCTCGTCC 721 TGAAGATGCA GCTGTTCTTA GCTCGGCAGG ACTGGGAGCA GACAGTAGAA ATGGGACACA 781 GAATCCTAGA AAAAGATGAG AGCAATATTG ATGCCTGCCA AATTCTAACC GTGCATGAGC 841 TTGCAAGAGA AGGAAACATG ACCACAGTAA GTTCTTTGAA GACTCAGAAG GTGATCCTTG 901 AAACAGAATC AAGGAGGAAC CCTTCATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAGGTGGAC 1081 GCTCAACCGA CCGCGGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt