Transcript: Human XM_006713011.4

PREDICTED: Homo sapiens tetratricopeptide repeat domain 21A (TTC21A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC21A (199223)
Length:
4278
CDS:
116..4072

Additional Resources:

NCBI RefSeq record:
XM_006713011.4
NBCI Gene record:
TTC21A (199223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242433 TGAAGCGGCCATCAATCTTTA pLKO_005 3013 CDS 100% 13.200 18.480 N TTC21A n/a
2 TRCN0000242434 ACTGAGGCAATTGAGTATTAT pLKO_005 2429 CDS 100% 15.000 10.500 N TTC21A n/a
3 TRCN0000243935 CCCAAGCAGTCCTGCTATATG pLKO_005 2156 CDS 100% 13.200 9.240 N TTC21A n/a
4 TRCN0000168124 GCAATATTGATGCCTGCCAAA pLKO.1 852 CDS 100% 4.050 2.835 N TTC21A n/a
5 TRCN0000172588 GCCGTGATCTTGAATCCTGTA pLKO.1 1553 CDS 100% 4.050 2.835 N TTC21A n/a
6 TRCN0000243936 GGAAGTCTGAGGTGCTAATTT pLKO_005 1296 CDS 100% 15.000 9.000 N TTC21A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13378 pDONR223 100% 20.9% 20.5% None (many diffs) n/a
2 ccsbBroad304_13378 pLX_304 0% 20.9% 20.5% V5 (many diffs) n/a
3 TRCN0000478450 AGGTGGACGCTCAACCGACCGCGG pLX_317 38.8% 20.9% 20.5% V5 (many diffs) n/a
Download CSV