Construct: ORF TRCN0000478473
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011943.1_s317c1
- Derived from:
- ccsbBroadEn_04788
- DNA Barcode:
- TAATGAAAAATCCCAGCTGAAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OVCA2 (124641)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478473
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 124641 | OVCA2 | OVCA2 serine hydrolase doma... | NM_080822.3 | 100% | 100% | |
| 2 | human | 1801 | DPH1 | diphthamide biosynthesis 1 | NR_144475.1 | 24.2% | (many diffs) | |
| 3 | human | 1801 | DPH1 | diphthamide biosynthesis 1 | NR_144474.1 | 23.9% | (many diffs) | |
| 4 | human | 1801 | DPH1 | diphthamide biosynthesis 1 | NR_144476.1 | 23.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 747
- ORF length:
- 681
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgcgcagcga cccctgcggg tcctgtgcct ggcgggcttc cggcagagcg 121 agcggggctt ccgtgagaag accggggcgc tgaggaaggc gctgcggggt cgcgccgagc 181 tcgtgtgcct cagcggcccg cacccggtcc ccgacccccc gggccccgag ggcgccagat 241 cagacttcgg gtcctgccct ccggaggagc agcctcgagg ctggtggttt tcagagcagg 301 aggccgacgt tttctccgca ttggaagagc ccgccgtctg caggggcctg gaggaatcac 361 tggggatggt ggcacaggca ctgaacaggc tggggccttt tgacggccTT CTTGGTTTCA 421 GCCAAGGGGC TGCGCTAGCA GCCCTTGTGT GTGCCCTGGG CCAGGCAGGC GATCCCCGCT 481 TCCCCTTGCC ACGGTTTATC CTCTTGGTGT CTGGTTTCTG TCCCCGGGGC ATTGGGTTCA 541 AGGAATCCAT CCTGCAAAGG CCCTTGTCAT TGCCTTCGCT CCATGTTTTT GGGGACACTG 601 ACAAAGTCAT CCCCTCTCAG GAGAGTGTGC AACTGGCCAG CCAATTTCCC GGAGCCATCA 661 CCCTCACCCA CTCTGGTGGC CACTTCATTC CAGCAGCTGC ACCCCAGCGT CAGGCCTACC 721 TCAAGTTCTT GGACCAGTTT GCAGAGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 781 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 841 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATAATGAAA 901 AATCCCAGCT GAAGGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 961 aagatt