Transcript: Human NR_144475.1

Homo sapiens diphthamide biosynthesis 1 (DPH1), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
DPH1 (1801)
Length:
2543
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144475.1
NBCI Gene record:
DPH1 (1801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139970 GACATCCGGATAGACACTACA pLKO.1 509 3UTR 100% 4.950 6.930 N DPH1 n/a
2 TRCN0000142802 CATATAGCAAAGTCCTATCCA pLKO.1 1139 3UTR 100% 3.000 4.200 N DPH1 n/a
3 TRCN0000140520 GCTTACCGGTATGACCCATAT pLKO.1 1123 3UTR 100% 10.800 7.560 N DPH1 n/a
4 TRCN0000292309 GCTTACCGGTATGACCCATAT pLKO_005 1123 3UTR 100% 10.800 7.560 N DPH1 n/a
5 TRCN0000139600 CTTCCATCTGGAGTCTGTCAT pLKO.1 1080 3UTR 100% 4.950 3.465 N DPH1 n/a
6 TRCN0000297980 CTTCCATCTGGAGTCTGTCAT pLKO_005 1080 3UTR 100% 4.950 3.465 N DPH1 n/a
7 TRCN0000140470 GCTGTACGTCTTTGTGGACAT pLKO.1 493 3UTR 100% 4.050 2.835 N DPH1 n/a
8 TRCN0000139971 GATAGACACTACACACCTCCT pLKO.1 517 3UTR 100% 2.160 1.512 N DPH1 n/a
9 TRCN0000297982 GATAGACACTACACACCTCCT pLKO_005 517 3UTR 100% 2.160 1.512 N DPH1 n/a
10 TRCN0000359444 GTTAAGAGACAACTATCAATT pLKO_005 2330 3UTR 100% 13.200 6.600 Y OVCA2 n/a
11 TRCN0000368596 TGCAACTGGCCAGCCAATTTC pLKO_005 2095 3UTR 100% 13.200 6.600 Y OVCA2 n/a
12 TRCN0000359520 ACTCTGGTGGCCACTTCATTC pLKO_005 2137 3UTR 100% 10.800 5.400 Y OVCA2 n/a
13 TRCN0000359443 CTGCAAAGGCCCTTGTCATTG pLKO_005 2019 3UTR 100% 10.800 5.400 Y OVCA2 n/a
14 TRCN0000141976 GAAATGTCTCTGCTCCTACAT pLKO.1 2225 3UTR 100% 4.950 2.475 Y DPH1 n/a
15 TRCN0000038109 CCTCAAGTTCTTGGACCAGTT pLKO.1 2186 3UTR 100% 4.050 2.025 Y OVCA2 n/a
16 TRCN0000038111 CATTGGGTTCAAGGAATCCAT pLKO.1 1997 3UTR 100% 3.000 1.500 Y OVCA2 n/a
17 TRCN0000038112 CGGTTTATCCTCTTGGTGTCT pLKO.1 1959 3UTR 100% 2.640 1.320 Y OVCA2 n/a
18 TRCN0000038113 CCCTCTCAGGAGAGTGTGCAA pLKO.1 2079 3UTR 100% 0.880 0.440 Y OVCA2 n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 941 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 941 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13846 pDONR223 99.8% 40.9% None (many diffs) n/a
2 ccsbBroad304_13846 pLX_304 0% 40.9% V5 (many diffs) n/a
3 TRCN0000471915 TGGACTAGCCTACATAATATCCTT pLX_317 42.2% 40.9% V5 (many diffs) n/a
4 ccsbBroadEn_04788 pDONR223 100% 24.2% None (many diffs) n/a
5 ccsbBroad304_04788 pLX_304 0% 24.2% V5 (many diffs) n/a
6 TRCN0000478473 TAATGAAAAATCCCAGCTGAAGGT pLX_317 49.7% 24.2% V5 (many diffs) n/a
Download CSV