Construct: ORF TRCN0000478491
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018058.1_s317c1
- Derived from:
- ccsbBroadEn_04483
- DNA Barcode:
- TCCGGCTTCCATTAAGTATATCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC22A16 (85413)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478491
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 85413 | SLC22A16 | solute carrier family 22 me... | NM_033125.4 | 100% | 100% | |
2 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536204.3 | 92.5% | 92.5% | 0_1ins129 |
3 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536205.2 | 89.1% | 88.5% | (many diffs) |
4 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536206.2 | 82.9% | 80.5% | (many diffs) |
5 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536208.3 | 77.4% | 68.7% | 0_1ins28;143_144ins362 |
6 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536207.3 | 76.5% | 71.5% | (many diffs) |
7 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536209.3 | 76.2% | 71.3% | (many diffs) |
8 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536210.1 | 73.3% | 68.7% | 1182_1183ins128;1269_1270ins334 |
9 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536211.2 | 72.2% | 72.2% | 171_172ins480 |
10 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_005267184.4 | 70% | 69.6% | (many diffs) |
11 | human | 85413 | SLC22A16 | solute carrier family 22 me... | XM_011536212.2 | 60.1% | 60.1% | 0_1ins690 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1797
- ORF length:
- 1731
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gtcccgccac ttcgagggga tttatgacca cgtggggcac ttcggcagat 121 tccagagagt cctctatttc atatgtgcct tccagaacat ctcttgtggt attcactact 181 tggcttctgt gttcatggga gtcacccctc atcatgtctg caggccccca ggcaatgtga 241 gtcaggttgt tttccataat cactctaatt ggagtttgga ggacaccggg gccctgttgt 301 cttcaggcca gaaagattat gttacggtgc agttgcagaa tggtgagatc tgggagctct 361 caaggtgtag caggaataag agggagaaca catcgagttt gggctatgaa tacactggca 421 gtaagaaaga gtttccttgt gtggatggct acatatatga ccagaacaca tggaaaagca 481 ctgcggtgac ccagtggaac ctggtctgtg accgaaaatg gcttgcaatg ctgatccagc 541 ccctatttat gtttggagtc ctactgggat cggtgacttt tggctacttt tctgacaggc 601 taggacgccg ggtggtcttg tgggccacaa gcagtagcat gtttttgttt ggaatagcag 661 cggcgtttgc agttgattat tacaccttca tggctgctcg cttttttctt gccatggttg 721 caagtggcta tcttgtggtg gggtttgtct atgtgatgga attcattggc atgaagtctc 781 ggacatgggc gtctgtccat ttgcattcct tttttgcagt tggaaccctg ctggtggctt 841 tgacaggata cttggtcagg acctggtggc tttaccagat gatcctctcc acagtgactg 901 tcccctttat cctgtgctgt tgggtgctcc cagagacacc tttttggctt ctctcagagg 961 gacgatatga agaagcacaa aaaatagttg acatcatggc caagtggaac agggcaagct 1021 cctgtaaact gtcagaactt ttatcactgg acctacaagg tcctgttagt aatagcccca 1081 ctgaagttca gaagcacaac ctatcatatc tgttttataa ctggagcatt acgaaaagga 1141 cacttaccgt ttggctaatc tggttcactg gaagtttggg attctactcg ttttccttga 1201 attctgttaa cttaggaggc aatgaatact taaacctctt cctcctgggt gtagtggaaa 1261 ttcccgccta caccttcgtg tgcatcgcca tggacaaggt cgggaggaga acagtcctgg 1321 cctactctct tttctgcagt gcactggcct gtggtgtcgt tatggtgatc ccccagaaac 1381 attatatttt gggtgtggtg acagctatgg ttggaaaatt tgccatcggg gcagcatttg 1441 gcctcattta tctttataca gctgagctgt atccaaccat tgtaagatcg ctggctgtgg 1501 gaagcggcag catggtgtgt cgcctggcca gcatcctggc gccgttctct gtggaccTCA 1561 GCAGCATTTG GATCTTCATA CCACAGTTGT TTGTTGGGAC TATGGCCCTC CTGAGTGGAG 1621 TGTTAACACT AAAGCTTCCA GAAACCCTTG GGAAACGGCT AGCAACTACT TGGGAGGAGG 1681 CTGCAAAACT GGAGTCAGAG AATGAAAGCA AGTCAAGCAA ATTACTTCTC ACAACTAATA 1741 ATAGTGGGCT GGAAAAAACG GAAGCGATTA CCCCCAGGGA TTCTGGTCTT GGTGAATACC 1801 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1861 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TTTTGGCTTT 1921 ATATATCTTG TGGAAAGGAC GATCCGGCTT CCATTAAGTA TATCAGACGC GTTAAGTCga 1981 caatcaacct ctggattaca aaatttgtga aagatt