Transcript: Human XM_011536208.3

PREDICTED: Homo sapiens solute carrier family 22 member 16 (SLC22A16), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A16 (85413)
Length:
1658
CDS:
129..1472

Additional Resources:

NCBI RefSeq record:
XM_011536208.3
NBCI Gene record:
SLC22A16 (85413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038275 CGGCGTTTGCAGTTGATTATT pLKO.1 334 CDS 100% 15.000 21.000 N SLC22A16 n/a
2 TRCN0000038274 GCTGTCTAGCACCTGAAATAT pLKO.1 1486 3UTR 100% 15.000 10.500 N SLC22A16 n/a
3 TRCN0000038277 CCAGAACATCTCTTGTGGTAT pLKO.1 187 CDS 100% 4.950 3.465 N SLC22A16 n/a
4 TRCN0000038276 GCTGAGCTGTATCCAACCATT pLKO.1 1134 CDS 100% 4.950 3.465 N SLC22A16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04483 pDONR223 100% 77.4% 68.7% None 0_1ins28;143_144ins362 n/a
2 ccsbBroad304_04483 pLX_304 0% 77.4% 68.7% V5 0_1ins28;143_144ins362 n/a
3 TRCN0000478491 TCCGGCTTCCATTAAGTATATCAG pLX_317 14.2% 77.4% 68.7% V5 0_1ins28;143_144ins362 n/a
Download CSV