Construct: ORF TRCN0000478507
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008141.1_s317c1
- Derived from:
- ccsbBroadEn_11617
- DNA Barcode:
- AGTGAAGCAAGTTAGTCGTAATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SNF8 (11267)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478507
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | NM_001317192.2 | 100% | 100% | |
2 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | NM_007241.4 | 99.6% | 99.6% | 563_565delAGA |
3 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | NM_001317193.2 | 93% | 93% | 52_53ins51;512_514delAGA |
4 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | NM_001317194.2 | 58.3% | 55.4% | (many diffs) |
5 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | XM_017024075.2 | 58.3% | 55.4% | (many diffs) |
6 | human | 11267 | SNF8 | SNF8 subunit of ESCRT-II | NR_133679.2 | 37% | (many diffs) | |
7 | mouse | 27681 | Snf8 | SNF8, ESCRT-II complex subu... | NM_033568.2 | 90.5% | 98% | (many diffs) |
8 | mouse | 27681 | Snf8 | SNF8, ESCRT-II complex subu... | XM_006533468.1 | 82.4% | 89.4% | (many diffs) |
9 | mouse | 27681 | Snf8 | SNF8, ESCRT-II complex subu... | XM_006533467.1 | 79.6% | 75.6% | (many diffs) |
10 | mouse | 27681 | Snf8 | SNF8, ESCRT-II complex subu... | XM_017314573.1 | 52% | 55.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 837
- ORF length:
- 771
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ccgccgcggg gtgggagctg gcgccatcgc caagaagaaa cttgcagagg 121 ccaagtataa ggagcgaggg acggtcttgg ctgaggacca gctagcccag atgtcaaagc 181 agttggacat gttcaagacc aacctggagg aatttgccag caaacacaag caggagatcc 241 ggaagaatcc tgagttccgt gtgcagttcc aggacatgtg tgcaaccatt ggcgtggatc 301 cgctggcctc tggaaaagga ttttggtctg agatgctggg cgtgggggac ttctattacg 361 aactaggtgt ccaaattatc gaagtgtgcc tggcgctgaa gcatcggaat ggaggtctga 421 taactttgga ggaactacat caacaggtgt tgaagggaag gggcaagttc gcccaggatg 481 tcagtcaaga tgaccTGATC AGAGCCATCA AGAAACTAAA GGCACTTGGC ACTGGCTTCG 541 GCATCATCCC TGTGGGCGGC ACTTACCTCA TTCAGTCTGT TCCAGCTGAG CTCAATATGG 601 ATCACACCGT GGTGCTGCAG CTGGCAGAGA ATGGCTACGT GACTGTCAGT GAGATCAAAG 661 CCAGTCTTAA ATGGGAGACC GAGCGAGCGC GGCAAGTGCT GGAACACCTG CTGAAGGAAG 721 GGTTGGCGTG GCTGGACTTA CAGGCCCCAG GGGAGGCCCA CTACTGGCTG CCAGCTCTCT 781 TCACTGACCT CTACTCCCAG GAGATTACAG CTGAGGAGGC CAGAGAAGCC CTCCCCTGCC 841 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 901 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 961 ATATATCTTG TGGAAAGGAC GAAGTGAAGC AAGTTAGTCG TAATCTACGC GTTAAGTCga 1021 caatcaacct ctggattaca aaatttgtga aagatt