Transcript: Mouse NM_033568.2

Mus musculus SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) (Snf8), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Snf8 (27681)
Length:
947
CDS:
98..874

Additional Resources:

NCBI RefSeq record:
NM_033568.2
NBCI Gene record:
Snf8 (27681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081988 CCTAGAAGAATTTGCCAGCAA pLKO.1 235 CDS 100% 2.640 3.696 N Snf8 n/a
2 TRCN0000381473 TTAAATGGGAGACGGAGCGAG pLKO_005 702 CDS 100% 2.160 3.024 N Snf8 n/a
3 TRCN0000382504 GTATGTGACTGTCAGTGAAAT pLKO_005 670 CDS 100% 13.200 10.560 N Snf8 n/a
4 TRCN0000081990 CTGGGTGTCCAGATTATTGAA pLKO.1 395 CDS 100% 5.625 4.500 N Snf8 n/a
5 TRCN0000302121 CTGGGTGTCCAGATTATTGAA pLKO_005 395 CDS 100% 5.625 4.500 N Snf8 n/a
6 TRCN0000081992 CTCAATATGGATCACACTGTT pLKO.1 623 CDS 100% 4.950 3.465 N Snf8 n/a
7 TRCN0000302056 CTCAATATGGATCACACTGTT pLKO_005 623 CDS 100% 4.950 3.465 N Snf8 n/a
8 TRCN0000081989 GAGCTACATCAGCAGGTGTTA pLKO.1 464 CDS 100% 4.950 3.465 N Snf8 n/a
9 TRCN0000302122 GAGCTACATCAGCAGGTGTTA pLKO_005 464 CDS 100% 4.950 3.465 N Snf8 n/a
10 TRCN0000081991 GCTGGACATGTTCAAGACCAA pLKO.1 214 CDS 100% 2.640 1.848 N Snf8 n/a
11 TRCN0000331797 GCTGGACATGTTCAAGACCAA pLKO_005 214 CDS 100% 2.640 1.848 N Snf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07790 pDONR223 100% 90.6% 98% None (many diffs) n/a
2 ccsbBroad304_07790 pLX_304 0% 90.6% 98% V5 (many diffs) n/a
3 TRCN0000472322 TTGGCACTTCTTTCACCTGATATC pLX_317 63.4% 90.6% 98% V5 (many diffs) n/a
4 ccsbBroadEn_11617 pDONR223 100% 90.5% 98% None (many diffs) n/a
5 ccsbBroad304_11617 pLX_304 0% 90.5% 98% V5 (many diffs) n/a
6 TRCN0000478507 AGTGAAGCAAGTTAGTCGTAATCT pLX_317 44.5% 90.5% 98% V5 (many diffs) n/a
Download CSV