Construct: ORF TRCN0000478508
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007440.1_s317c1
- Derived from:
- ccsbBroadEn_03317
- DNA Barcode:
- AGTCTCTTATATATGAATGCAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HIKESHI (51501)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478508
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NM_016401.4 | 100% | 100% | |
| 2 | human | 51501 | HIKESHI | heat shock protein nuclear ... | XM_017017914.2 | 90.8% | 90.8% | 537_538ins54 |
| 3 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NM_001322404.2 | 89.8% | 89.8% | 415_416ins60 |
| 4 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NM_001322407.2 | 80.2% | 80.2% | 0_1ins117 |
| 5 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NM_001322409.2 | 80.2% | 80.2% | 0_1ins117 |
| 6 | human | 51501 | HIKESHI | heat shock protein nuclear ... | XM_017017915.1 | 80.2% | 80.2% | 0_1ins117 |
| 7 | human | 51501 | HIKESHI | heat shock protein nuclear ... | XR_949963.3 | 49.2% | 1_209del;748_852del;906_1201del | |
| 8 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NR_136324.2 | 47.9% | 1_209del;477_600del;925_1232del | |
| 9 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NR_024598.2 | 47.7% | (many diffs) | |
| 10 | human | 51501 | HIKESHI | heat shock protein nuclear ... | NR_024597.2 | 43% | (many diffs) | |
| 11 | human | 51501 | HIKESHI | heat shock protein nuclear ... | XR_001747904.2 | 36.4% | (many diffs) | |
| 12 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | NM_026304.3 | 93% | 96.9% | (many diffs) |
| 13 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | NM_001291286.1 | 83.4% | 87.3% | (many diffs) |
| 14 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | NM_001291287.1 | 73.7% | 77.6% | (many diffs) |
| 15 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | XM_006508132.3 | 73.7% | 77.6% | (many diffs) |
| 16 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | XM_006508133.3 | 62.7% | 45.1% | (many diffs) |
| 17 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | NM_001291288.1 | 45.3% | 47.7% | (many diffs) |
| 18 | mouse | 67669 | Hikeshi | heat shock protein nuclear ... | NM_001291289.1 | 45.3% | 47.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 657
- ORF length:
- 591
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaat 61 ttggcatgtt tggctgcttg gtggcgggga ggctggtgca aacagctgca cagcaagtgg 121 cagaggataa atttgttttt gacttacctg attatgaaag tatcaaccat gttgtggttt 181 ttatgctggg aacaatccca tttcctgagg gaatgggagg atctgtctac ttttcttatc 241 ctgattcaaa tggaatgcca gtatggcaac tcctaggatt tgtcacgaat gggaagccaa 301 gtgccatctt caaaatttca ggtcttaaat ctggagaagg aagccaacat ccttttGGAG 361 CCATGAATAT TGTCCGAACT CCATCTGTTG CTCAGATTGG AATTTCAGTG GAATTATTAG 421 ACAGTATGGC TCAGCAGACT CCTGTAGGTA ATGCTGCTGT ATCCTCAGTT GACTCATTCA 481 CTCAGTTCAC ACAAAAGATG TTGGACAATT TCTACAATTT TGCTTCATCA TTTGCTGTCT 541 CTCAGGCCCA GATGACACCA AGCCCATCTG AAATGTTCAT TCCGGCAAAT GTGGTTCTGA 601 AATGGTATGA AAACTTTCAA AGACGACTAG CACAGAACCC TCTCTTTTGG AAAACATACC 661 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 721 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 781 ATATATCTTG TGGAAAGGAC GAAGTCTCTT ATATATGAAT GCAATCACGC GTTAAGTCga 841 caatcaacct ctggattaca aaatttgtga aagatt