Transcript: Human NM_016401.4

Homo sapiens heat shock protein nuclear import factor hikeshi (HIKESHI), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HIKESHI (51501)
Length:
1108
CDS:
210..803

Additional Resources:

NCBI RefSeq record:
NM_016401.4
NBCI Gene record:
HIKESHI (51501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135546 GTATGGCAACTCCTAGGATTT pLKO.1 405 CDS 100% 10.800 15.120 N HIKESHI n/a
2 TRCN0000137755 GAATGGGAGGATCTGTCTACT pLKO.1 355 CDS 100% 4.950 3.960 N HIKESHI n/a
3 TRCN0000136065 GCAAGTGGCAGAGGATAAATT pLKO.1 257 CDS 100% 15.000 10.500 N HIKESHI n/a
4 TRCN0000217695 GCAAGTGGCAGAGGATAAATT pLKO.1 257 CDS 100% 15.000 10.500 N Hikeshi n/a
5 TRCN0000138317 CAGTATGGCAACTCCTAGGAT pLKO.1 403 CDS 100% 3.000 2.100 N HIKESHI n/a
6 TRCN0000135748 CCTGATTCAAATGGAATGCCA pLKO.1 384 CDS 100% 0.750 0.525 N HIKESHI n/a
7 TRCN0000250902 AGCAAGTGGCAGAGGATAAAT pLKO_005 256 CDS 100% 15.000 9.000 N Hikeshi n/a
8 TRCN0000138717 GAAGCCAAGTGCCATCTTCAA pLKO.1 437 CDS 100% 4.950 2.970 N HIKESHI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03317 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03317 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478508 AGTCTCTTATATATGAATGCAATC pLX_317 50.9% 100% 100% V5 n/a
4 ccsbBroadEn_08300 pDONR223 100% 99.8% 99.4% None 139C>G n/a
5 ccsbBroad304_08300 pLX_304 0% 99.8% 99.4% V5 139C>G n/a
6 TRCN0000465240 ATCCTCCAGCGTATTCTTCTACCC pLX_317 50.9% 99.8% 99.4% V5 139C>G n/a
Download CSV