Construct: ORF TRCN0000478668
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002601.1_s317c1
- Derived from:
- ccsbBroadEn_09556
- DNA Barcode:
- ATACATAACTCGATTTAAGCTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IRAK1BP1 (134728)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478668
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | NM_001010844.4 | 99.8% | 100% | 318A>G |
2 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XM_011535447.1 | 94.5% | 96.5% | (many diffs) |
3 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XM_006715336.3 | 88.2% | 86.8% | (many diffs) |
4 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XR_942279.2 | 69.7% | (many diffs) | |
5 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XR_001743162.1 | 59.8% | (many diffs) | |
6 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XM_011535448.2 | 57.5% | 50.3% | (many diffs) |
7 | human | 134728 | IRAK1BP1 | interleukin 1 receptor asso... | XM_017010265.1 | 53% | 46.9% | (many diffs) |
8 | mouse | 65099 | Irak1bp1 | interleukin-1 receptor-asso... | NM_022986.4 | 82.9% | 82.3% | (many diffs) |
9 | mouse | 65099 | Irak1bp1 | interleukin-1 receptor-asso... | NM_001168240.1 | 75.7% | 75% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 849
- ORF length:
- 780
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctctgcaa aagacccctc cgacccgagt gttcgtggaa ctggttccct 121 gggctgaccg gagccgggag aacaacctgg cctcagggag agagacgcta ccgggcttac 181 gccaccccct ctcctcaaca caagcccaaa ctgctacccg cgaggtgcaa gtaagcggca 241 cctcagaagt gtctgcgggc cctgaccggg cgcaggtggt ggtgcgagtg agcagcacca 301 aggaggcggc agccgaggcc aaaaagagcg tttgtcgccg tctagattac atcacgcaga 361 gcctccagca gcagggcgtg caggcggaaa atataactgt gacaaaggat tttaggagag 421 tggaaaatgc ttatcacatg gaagcagagg tctgcattac atttactgaa tttggaaaaa 481 tgcaaaatat ttgtaacttt cttgtTGAAA AGCTAGATAG CTCTGTTGTC ATCAGCCCAC 541 CCCAGTTCTA TCATACTCCA GGTTCTGTTG AGAATCTTCG ACGGCAAGCC TGTCTTGTTG 601 CTGTTGAGAA TGCGTGGCGC AAAGCTCAAG AAGTCTGTAA CCTTGTTGGC CAAACCTTAG 661 GAAAACCTTT ACTAATCAAA GAAGAAGAAA CAAAAGAATG GGAAGGCCAA ATAGATGATC 721 ACCAGTCATC CAGACTCTCA AGTTCATTAA CTGTACAACA AAAAATCAAA AGTGCAACAA 781 TACATGCTGC TTCAAAAGTA TTTATAACTT TTGAGGTAAA GGGAAAAGAG AAGAGAAAAA 841 AGCACCTTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATACAT AACTCGATTT AAGCTTTTAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt