Transcript: Human XM_017010265.1

PREDICTED: Homo sapiens interleukin 1 receptor associated kinase 1 binding protein 1 (IRAK1BP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRAK1BP1 (134728)
Length:
642
CDS:
92..544

Additional Resources:

NCBI RefSeq record:
XM_017010265.1
NBCI Gene record:
IRAK1BP1 (134728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052537 TCTCCTCAACACAAGCCCAAA pLKO.1 213 CDS 100% 4.050 2.835 N IRAK1BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09556 pDONR223 100% 53% 46.9% None (many diffs) n/a
2 ccsbBroad304_09556 pLX_304 0% 53% 46.9% V5 (many diffs) n/a
3 TRCN0000478668 ATACATAACTCGATTTAAGCTTTT pLX_317 44% 53% 46.9% V5 (many diffs) n/a
Download CSV