Construct: ORF TRCN0000478671
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017815.1_s317c1
- Derived from:
- ccsbBroadEn_02749
- DNA Barcode:
- CACAGTCCCGAGGGACATCACTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NEMP1 (23306)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478671
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23306 | NEMP1 | nuclear envelope integral m... | NM_015257.3 | 100% | 100% | |
| 2 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_011538058.3 | 84.3% | 78% | (many diffs) |
| 3 | human | 23306 | NEMP1 | nuclear envelope integral m... | NM_001130963.2 | 83.5% | 83.5% | 327_545del |
| 4 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_011538057.2 | 74.2% | 71.4% | (many diffs) |
| 5 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_024448900.1 | 74.2% | 71.4% | (many diffs) |
| 6 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_011538059.1 | 73% | 70.4% | (many diffs) |
| 7 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_017019078.1 | 73% | 70.4% | (many diffs) |
| 8 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_011538056.2 | 71.9% | 66.7% | (many diffs) |
| 9 | human | 23306 | NEMP1 | nuclear envelope integral m... | XM_017019079.1 | 68.1% | 68.1% | 0_1ins354 |
| 10 | mouse | 210035 | Nemp1 | nuclear envelope integral m... | NM_001113211.1 | 70.3% | 67.4% | (many diffs) |
| 11 | mouse | 210035 | Nemp1 | nuclear envelope integral m... | XM_011243393.1 | 57.5% | 56.3% | (many diffs) |
| 12 | mouse | 210035 | Nemp1 | nuclear envelope integral m... | NM_173732.3 | 48.5% | 46.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1182
- ORF length:
- 1113
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgggagga atgaaagtgg cggtctcgcc ggcagttggt cccgggccct 121 ggggctcggg agtcgggggc ggtgggacag tgcggctact cttgatcctc tccggctgct 181 tggtctacgg cacagctgaa actgatgtaa atgtggtcat gcttcaggaa tcccaagttt 241 gtgaaaagcg tgccagccaa caattctgtt acacaaatgt gcttatccca aaatggcatg 301 atatatggac acggatacag atccgagtaa atagttccag attggttcga gtcacccagg 361 tggagaatga ggagaaactg aaggagctag agcaaagtca aattttctac tactctactg 421 ggatgactgt gggaattgtg gcctctctgc taatcatcat ttttatacta tctaagttta 481 tgcctaagaa aagtcccatt tacgtcatcc tggtgggagg ctggtctttt tctctgtacc 541 tcattcaact agtttttaaa aatttacaag agatctggag gtgttactgg cagtatcttt 601 taagttatgt cctcacagtt ggattcatga gttttgcagt atgttacaag tatgggccct 661 tggagaatga acgaagtatc aacctgctga cctggacctt gcagctgatg ggccTGTGTT 721 TCATGTATTC TGGCATCCAG ATACCACATA TTGCCCTTGC CATTATCATC ATTGCTCTTT 781 GTACTAAGAA CCTGGAACAC CCTATTCAGT GGCTGTACAT CACCTGCAGA AAGGTGTGTA 841 AGGGAGCAGA AAAGCCTGTT CCCCCTCGTC TCCTGACAGA AGAAGAATAT CGGATACAAG 901 GAGAGGTAGA AACCCGAAAG GCTTTAGAGG AGCTCCGAGA ATTTTGTAAC AGTCCAGACT 961 GCTCTGCTTG GAAGACTGTT TCTCGAATCC AGTCTCCAAA AAGATTTGCT GACTTTGTGG 1021 AAGGCTCTTC CCACCTCACG CCAAATGAAG TTTCTGTCCA TGAGCAGGAG TATGGATTAG 1081 GGAGCATTAT TGCCCAGGAT GAAATCTATG AGGAAGCATC CTCTGAGGAG GAGGACTCAT 1141 ATTCTCGGTG TCCTGCTATC ACACAGAACA ACTTTCTAAC CTTGCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGACAC AGTCCCGAGG GACATCACTG GACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t