Transcript: Human XM_017019079.1

PREDICTED: Homo sapiens nuclear envelope integral membrane protein 1 (NEMP1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEMP1 (23306)
Length:
5521
CDS:
524..1285

Additional Resources:

NCBI RefSeq record:
XM_017019079.1
NBCI Gene record:
NEMP1 (23306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129583 CGGATACAAGGAGAGGTAGAA pLKO.1 992 CDS 100% 4.950 6.930 N NEMP1 n/a
2 TRCN0000150000 CGTCTGTTACAAAGGGAATTT pLKO.1 4234 3UTR 100% 13.200 10.560 N NEMP1 n/a
3 TRCN0000147157 CCGAGTAAATAGTTCCAGATT pLKO.1 278 5UTR 100% 4.950 3.960 N NEMP1 n/a
4 TRCN0000234821 GGTAATACCTTAGGGTTATTT pLKO_005 5315 3UTR 100% 15.000 10.500 N NEMP1 n/a
5 TRCN0000146270 CCTCTCTGCTAATCATCATTT pLKO.1 543 CDS 100% 13.200 9.240 N NEMP1 n/a
6 TRCN0000234820 CTGAGGAGGAGGACTCATATT pLKO_005 1224 CDS 100% 13.200 9.240 N NEMP1 n/a
7 TRCN0000234818 TGGCATCCAGATACCACATAT pLKO_005 832 CDS 100% 13.200 9.240 N NEMP1 n/a
8 TRCN0000234819 AGAACCTGGAACACCCTATTC pLKO_005 888 CDS 100% 10.800 7.560 N NEMP1 n/a
9 TRCN0000149005 GCATTATTGCCCAGGATGAAA pLKO.1 1185 CDS 100% 5.625 3.938 N NEMP1 n/a
10 TRCN0000148943 CCTTGGAGAATGAACGAAGTA pLKO.1 759 CDS 100% 4.950 3.465 N NEMP1 n/a
11 TRCN0000194186 GCAGTTTAGTATCTGGAACTT pLKO.1 347 5UTR 100% 4.950 3.465 N Nemp1 n/a
12 TRCN0000149969 CTTGGAAGACTGTTTCTCGAA pLKO.1 1068 CDS 100% 2.640 1.848 N NEMP1 n/a
13 TRCN0000149977 CCTTTGAAACAGAGTGAGATA pLKO.1 1363 3UTR 100% 4.950 2.970 N NEMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02749 pDONR223 100% 68.1% 68.1% None 0_1ins354 n/a
2 ccsbBroad304_02749 pLX_304 0% 68.1% 68.1% V5 0_1ins354 n/a
3 TRCN0000478671 CACAGTCCCGAGGGACATCACTGG pLX_317 42% 68.1% 68.1% V5 0_1ins354 n/a
Download CSV