Construct: ORF TRCN0000478888
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007786.1_s317c1
- Derived from:
- ccsbBroadEn_05942
- DNA Barcode:
- CCCCATCGCAGCAGCCCATCCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CBS (875)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478888
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001321073.2 | 100% | 100% | |
2 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354006.1 | 100% | 100% | |
3 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354007.1 | 100% | 100% | |
4 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354008.1 | 100% | 100% | |
5 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354009.1 | 100% | 100% | |
6 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354010.1 | 100% | 100% | |
7 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354012.1 | 100% | 100% | |
8 | human | 875 | CBS | cystathionine beta-synthase | NM_000071.2 | 99.9% | 100% | 699C>T |
9 | human | 875 | CBS | cystathionine beta-synthase | NM_001178008.2 | 99.9% | 100% | 699C>T |
10 | human | 875 | CBS | cystathionine beta-synthase | NM_001178009.3 | 99.9% | 100% | 699C>T |
11 | human | 875 | CBS | cystathionine beta-synthase | NM_001320298.1 | 99.9% | 100% | 699C>T |
12 | human | 875 | CBS | cystathionine beta-synthase | XM_017028491.2 | 99.9% | 100% | 699C>T |
13 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354014.1 | 97.5% | 97.3% | 1553_1594del |
14 | human | 102724560 | CBSL | cystathionine beta-synthase... | NM_001354015.1 | 97.5% | 97.3% | 1553_1594del |
15 | human | 875 | CBS | cystathionine beta-synthase | XM_011529777.2 | 97.4% | 97.3% | 699C>T;1553_1594del |
16 | human | 875 | CBS | cystathionine beta-synthase | XM_024452137.1 | 85.2% | 77.1% | (many diffs) |
17 | human | 102724560 | CBSL | cystathionine beta-synthase... | XM_017028209.1 | 85% | 77.1% | (many diffs) |
18 | human | 102724560 | CBSL | cystathionine beta-synthase... | XM_017028210.1 | 85% | 77.1% | (many diffs) |
19 | human | 875 | CBS | cystathionine beta-synthase | XM_011529774.2 | 83.2% | 75.2% | (many diffs) |
20 | human | 875 | CBS | cystathionine beta-synthase | XM_024452136.1 | 83.2% | 75.2% | (many diffs) |
21 | human | 875 | CBS | cystathionine beta-synthase | NM_001321072.1 | 80.8% | 80.7% | 1_1delAins316;384C>T |
22 | human | 875 | CBS | cystathionine beta-synthase | XM_024452138.1 | 80.8% | 80.7% | 1_1delAins316;384C>T |
23 | human | 875 | CBS | cystathionine beta-synthase | XM_024452139.1 | 80.8% | 80.7% | 1_1delAins316;384C>T |
24 | human | 875 | CBS | cystathionine beta-synthase | XM_024452140.1 | 80.8% | 80.7% | 1_1delAins316;384C>T |
25 | human | 875 | CBS | cystathionine beta-synthase | XR_001754917.2 | 80.8% | (many diffs) | |
26 | human | 875 | CBS | cystathionine beta-synthase | XM_011529783.2 | 78.8% | 78.5% | 1_1delAins316;384C>T;1238_1279del |
27 | human | 875 | CBS | cystathionine beta-synthase | XR_001754916.2 | 67.8% | (many diffs) | |
28 | human | 102724560 | CBSL | cystathionine beta-synthase... | NR_148682.1 | 60.7% | (many diffs) | |
29 | human | 875 | CBS | cystathionine beta-synthase | XR_001754915.1 | 53.1% | (many diffs) | |
30 | human | 875 | CBS | cystathionine beta-synthase | XR_002958634.1 | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1719
- ORF length:
- 1653
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ttctgagacc ccccaggcag aagtggggcc cacaggctgc ccccaccgct 121 cagggccaca ctcggcgaag gggagcctgg agaaggggtc cccagaggat aaggaagcca 181 aggagcccct gtggatccgg cccgatgctc cgagcaggtg cacctggcag ctgggccggc 241 ctgcctccga gtccccacat caccacactg ccccggcaaa atctccaaaa atcttgccag 301 atattctgaa gaaaatcggg gacaccccta tggtcagaat caacaagatt gggaagaagt 361 tcggcctgaa gtgtgagctc ttggccaagt gtgagttctt caacgcgggc gggagcgtga 421 aggaccgcat cagcctgcgg atgattgagg atgctgagcg cgacgggacg ctgaagcccg 481 gggacacgat tatcgagccg acatccggga acaccgggat cgggctggcc ctggctgcgg 541 cagtgagggg ctatcgctgc atcatcgtga tgccagagaa gatgagctcc gagaaggtgg 601 acgtgctgcg ggcactgggg gctgagattg tgaggacgcc caccaatgcc aggttcgact 661 ccccggagtc acacgtgggg gtggcctggc ggctgaagaa cgaaatcccc aattctcaca 721 tcctagacca gtaccgcaac gccagcaacc ccctggctca ctatgacacc accgctgatg 781 agatcctgca gcagtgtgat gggaagctgg acatgctggt ggcttcagtg ggcacgggcg 841 gcaccatcac gggcattgcc aggaagctga aggagaagtg tcctggatgc aggatcattg 901 gggtggatcc cgaagggtcc atcctcgcag agccggagga gctgaaccag acggagcaga 961 caacctacga ggtggaaggg atcggctacg acttcatccc cacggtgctg gacaggacgg 1021 tggtggacaa gtggttcaag agcaacgatg aggaggcgtt cacctttgcc cgcatgctga 1081 tcgcgcaaga ggggctgctg tgcggtggca gtgctggcag cacggtggcg gtggccgtga 1141 aggccgcgca ggagctgcag gagggccagc gctgcgtggt cattctgccc gactcagtgc 1201 ggaactacat gaccaagttc ctgagcgaca ggtggatgct gcagaagggc tttctgaagg 1261 aggaggacct cacggagaag aagccctggt ggtggcacct ccgtgttcag gagctgggcc 1321 tgtcagcccc gctgaccgtg ctcccgacca tcacctgtgg gcacaccatc gagatcctcc 1381 gggagaaggg cTTCGACCAG GCGCCCGTGG TGGATGAGGC GGGGGTAATC CTGGGAATGG 1441 TGACGCTTGG GAACATGCTC TCGTCCCTGC TTGCCGGGAA GGTGCAGCCG TCAGACCAAG 1501 TTGGCAAAGT CATCTACAAG CAGTTCAAAC AGATCCGCCT CACGGACACG CTGGGCAGGC 1561 TCTCGCACAT CCTGGAGATG GACCACTTCG CCCTGGTGGT GCACGAGCAG ATCCAGTACC 1621 ACAGCACCGG GAAGTCCAGT CAGCGGCAGA TGGTGTTCGG GGTGGTCACC GCCATTGACT 1681 TGCTGAACTT CGTGGCCGCC CAGGAGCGGG ACCAGAAGTG CCCAACTTTC TTGTACAAAG 1741 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1801 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1861 ACGACCCCAT CGCAGCAGCC CATCCTTTAC GCGTTAAGTC gacaatcaac ctctggatta 1921 caaaatttgt gaaagatt