Transcript: Human NM_001321073.2

Homo sapiens cystathionine beta-synthase like (CBSL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CBSL (102724560)
Length:
2438
CDS:
292..1947

Additional Resources:

NCBI RefSeq record:
NM_001321073.2
NBCI Gene record:
CBSL (102724560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308284 GACTGCGCAGAGTGGATTAAA pLKO_005 2026 3UTR 100% 15.000 7.500 Y CBS n/a
2 TRCN0000075999 CCCTATGGTCAGAATCAACAA pLKO.1 552 CDS 100% 4.950 2.475 Y Cbs n/a
3 TRCN0000045360 CTTGCCAGATATTCTGAAGAA pLKO.1 519 CDS 100% 4.950 2.475 Y CBS n/a
4 TRCN0000291472 CTTGCCAGATATTCTGAAGAA pLKO_005 519 CDS 100% 4.950 2.475 Y CBS n/a
5 TRCN0000045359 GCGGAACTACATGACCAAGTT pLKO.1 1425 CDS 100% 4.950 2.475 Y CBS n/a
6 TRCN0000291404 GCGGAACTACATGACCAAGTT pLKO_005 1425 CDS 100% 4.950 2.475 Y CBS n/a
7 TRCN0000045362 ACACGATTATCGAGCCGACAT pLKO.1 710 CDS 100% 4.050 2.025 Y CBS n/a
8 TRCN0000291406 ACACGATTATCGAGCCGACAT pLKO_005 710 CDS 100% 4.050 2.025 Y CBS n/a
9 TRCN0000045361 CCGTCAGACCAAGTTGGCAAA pLKO.1 1714 CDS 100% 4.050 2.025 Y CBS n/a
10 TRCN0000291407 CCGTCAGACCAAGTTGGCAAA pLKO_005 1714 CDS 100% 4.050 2.025 Y CBS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05942 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05942 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478888 CCCCATCGCAGCAGCCCATCCTTT pLX_317 20.2% 100% 100% V5 n/a
4 ccsbBroadEn_15377 pDONR223 0% 99.8% 99.8% None 205G>C;699T>C n/a
5 ccsbBroad304_15377 pLX_304 0% 99.8% 99.8% V5 205G>C;699T>C n/a
6 TRCN0000473237 CGTACTAATCGTGAAATTTGATAT pLX_317 21% 99.8% 99.8% V5 205G>C;699T>C n/a
7 ccsbBroadEn_05943 pDONR223 100% 99.8% 100% None 699T>C;1080C>T n/a
8 ccsbBroad304_05943 pLX_304 0% 99.8% 100% V5 699T>C;1080C>T n/a
9 TRCN0000477373 ATTTAAGCCGTCGACCATGCACTG pLX_317 15.8% 99.8% 100% V5 699T>C;1080C>T n/a
Download CSV