Construct: ORF TRCN0000478914
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014437.2_s317c1
- Derived from:
- ccsbBroadEn_08551
- DNA Barcode:
- TACACAGAGCCCAGTCACGCTAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS50 (55610)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478914
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | NM_024553.2 | 99.8% | 100% | 357T>C |
| 2 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | XM_011516396.3 | 46.6% | 46.4% | (many diffs) |
| 3 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | NM_017667.4 | 33% | 32.8% | (many diffs) |
| 4 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | NM_001257998.1 | 29.7% | 29.3% | (many diffs) |
| 5 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | XR_001744835.2 | 25% | (many diffs) | |
| 6 | human | 55610 | VPS50 | VPS50 subunit of EARP/GARPI... | XM_011516395.2 | 13.5% | 13.2% | (many diffs) |
| 7 | mouse | 73288 | Vps50 | VPS50 EARP/GARPII complex s... | NM_001167750.1 | 31.2% | 33.2% | (many diffs) |
| 8 | mouse | 73288 | Vps50 | VPS50 EARP/GARPII complex s... | NM_001167751.1 | 30.9% | 32.9% | (many diffs) |
| 9 | mouse | 73288 | Vps50 | VPS50 EARP/GARPII complex s... | NM_024260.5 | 30.1% | 32% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1047
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca aaaaatcaaa tctctcatga cccgacaggg tctgaaaagc cctcaagaaa 121 gcctcagtga tcttggtgcc atagagagtc tccgggtccc tggaaaggaa gaattcaggg 181 aacttcgaga acagccaagt gaccctcaag ctgaacaaga gcttattaat agtattgaac 241 aagtatattt ttctgtggat tcatttgata ttgttaaata tgagctggag aagcttccac 301 ctgttctcaa tttgcaagaa ttagaggcgt atagagacaa attgaaacaa cagcaagctg 361 cagtatctaa aaaagtggca gatttaatcc ttgaaaaaca gcctgcttat gtaaaggaac 421 tcgaaagagt tacctcattg cagacaggtc ttcaattagc tgctgttatc tgtacaaatg 481 ggagaagaca cttgaatatt gcaaaggaag gttttactca agctagttta ggccttcttg 541 caaatcaaag gaaacgtcag ttgctgattg gacttctgaa atctctgaga actataaaaa 601 cattgcaaag aacagatgta cggttaagtg aaatgctgga ggaggaagat tatccaggag 661 ctattcagtt gtgccttGAA TGTCAAAAAG CTGCCAGCAC TTTTAAACAT TACAGTTGTA 721 TAAGTGAACT GAATTCAAAG CTGCAAGATA CTTTGGAACA GATTGAGGAA CAGCTGGACG 781 TAGCTCTTTC CAAAATCTGC AAGAATTTTG ACATTAACCA TTATACCAAG GTTCAACAAG 841 CTTATCGACT TCTTGGAAAA ACACAGACAG CAATGGATCA ACTTCATATG CACTTCACCC 901 AAGCCATTCA CAACACCGTG TTTCAAGTTG TTCTTGGTTA TGTGGAACTA TGTGCAGGAA 961 ACACAGACAC AAAATTCCAA AAGCTGCAAT ATAAGGATCT CTGTACAGTA TGTAGTGACT 1021 TAATTACTAT TCATATATCT CTCCTTTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATACACAGA 1201 GCCCAGTCAC GCTAAAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt