Transcript: Mouse NM_024260.5

Mus musculus VPS50 EARP/GARPII complex subunit (Vps50), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vps50 (73288)
Length:
3780
CDS:
131..3025

Additional Resources:

NCBI RefSeq record:
NM_024260.5
NBCI Gene record:
Vps50 (73288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024260.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249664 GCCATTCACAACACCGTATTT pLKO_005 968 CDS 100% 13.200 10.560 N Vps50 n/a
2 TRCN0000249666 GTGACACCAGACAGCTATATT pLKO_005 1076 CDS 100% 15.000 10.500 N Vps50 n/a
3 TRCN0000249663 ATAGCATTGAACAAGTCTATT pLKO_005 294 CDS 100% 13.200 9.240 N Vps50 n/a
4 TRCN0000215336 CTATTACTTGTATGCCATATA pLKO.1 2062 CDS 100% 13.200 9.240 N Vps50 n/a
5 TRCN0000249665 CTATTACTTGTATGCCATATA pLKO_005 2062 CDS 100% 13.200 9.240 N Vps50 n/a
6 TRCN0000179049 CCCATCAGTTTCACCTAGTAA pLKO.1 1612 CDS 100% 5.625 3.938 N Vps50 n/a
7 TRCN0000183665 CGGATCCATTTGATATTGTTA pLKO.1 321 CDS 100% 5.625 3.938 N Vps50 n/a
8 TRCN0000215978 CAGTTTAACAAGCGGTTAAAT pLKO.1 2603 CDS 100% 1.500 1.050 N Vps50 n/a
9 TRCN0000215460 GAGGATGAATGTACAGTATTT pLKO.1 3377 3UTR 100% 13.200 7.920 N Vps50 n/a
10 TRCN0000257930 GAGGATGAATGTACAGTATTT pLKO_005 3377 3UTR 100% 13.200 7.920 N Vps50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024260.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08551 pDONR223 100% 30.1% 32% None (many diffs) n/a
2 ccsbBroad304_08551 pLX_304 0% 30.1% 32% V5 (many diffs) n/a
3 TRCN0000478914 TACACAGAGCCCAGTCACGCTAAA pLX_317 37.9% 30.1% 32% V5 (many diffs) n/a
Download CSV