Construct: ORF TRCN0000478941
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010423.1_s317c1
- Derived from:
- ccsbBroadEn_08317
- DNA Barcode:
- CGCCTGTGGTATCCAGTCTTTGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB6B (51560)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478941
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51560 | RAB6B | RAB6B, member RAS oncogene ... | NM_016577.4 | 99.8% | 100% | 567C>T |
| 2 | human | 51560 | RAB6B | RAB6B, member RAS oncogene ... | NM_001363953.1 | 92.3% | 89.9% | (many diffs) |
| 3 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_198896.2 | 78.8% | 90.8% | (many diffs) |
| 4 | human | 5870 | RAB6A | RAB6A, member RAS oncogene ... | NM_001243718.2 | 40.6% | 44.7% | (many diffs) |
| 5 | mouse | 270192 | Rab6b | RAB6B, member RAS oncogene ... | NM_173781.4 | 92.4% | 100% | (many diffs) |
| 6 | mouse | 270192 | Rab6b | RAB6B, member RAS oncogene ... | XM_006511737.2 | 85.1% | 88.2% | (many diffs) |
| 7 | mouse | 270192 | Rab6b | RAB6B, member RAS oncogene ... | XM_006511736.3 | 76.8% | 74.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 690
- ORF length:
- 624
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cgcaggggga gattttggga atccactgag aaaattcaag ttggtgttct 121 tgggggagca gagcgtcggg aagacgtctc tgattacgag gttcatgtac gacagcttcg 181 acaacacata ccaggcaacc attgggattg acttcttgtc aaaaaccatg tacttggagg 241 accgcacggt gcgactgcag ctctgggaca cagctggtca ggagaggttc cgcagcctga 301 tccccagcta catccgggac tccacggtgg ctgtggtggt gtacgacatc acaaatctca 361 actccttcca acagacctcT AAGTGGATCG ACGACGTCAG GACAGAGAGG GGCAGTGATG 421 TTATCATCAT GCTGGTGGGC AACAAGACGG ACCTGGCTGA TAAGAGGCAG ATAACCATCG 481 AGGAGGGGGA GCAGCGCGCC AAAGAACTGA GCGTCATGTT CATTGAGACC AGTGCGAAGA 541 CTGGCTACAA CGTGAAGCAG CTTTTTCGAC GTGTGGCGTC GGCTCTACCC GGAATGGAGA 601 ATGTCCAGGA GAAAAGCAAA GAAGGGATGA TTGACATCAA GCTGGACAAA CCCCAGGAGC 661 CCCCGGCCAG CGAGGGCGGC TGCTCCTGCT ACCCAACTTT CTTGTACAAA GTGGTTGATA 721 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 781 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACGCCT 841 GTGGTATCCA GTCTTTGCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 901 tgaaagatt