Transcript: Mouse XM_006511737.2

PREDICTED: Mus musculus RAB6B, member RAS oncogene family (Rab6b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab6b (270192)
Length:
4660
CDS:
16..630

Additional Resources:

NCBI RefSeq record:
XM_006511737.2
NBCI Gene record:
Rab6b (270192)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379825 TGATCACGAGGTTCATGTATG pLKO_005 89 CDS 100% 10.800 15.120 N Rab6b n/a
2 TRCN0000382386 ATCAAGACTGGAGGATCTTTC pLKO_005 711 3UTR 100% 10.800 8.640 N Rab6b n/a
3 TRCN0000380802 CAAGACGGATCTGGCTGATAA pLKO_005 381 CDS 100% 13.200 9.240 N Rab6b n/a
4 TRCN0000100903 CTGTGGTGGTATATGACATTA pLKO.1 269 CDS 100% 13.200 9.240 N Rab6b n/a
5 TRCN0000379911 GAACTGTGTGTCACCTCTATT pLKO_005 1049 3UTR 100% 13.200 9.240 N Rab6b n/a
6 TRCN0000379737 CTTAACAGCTGTTACCTAAAC pLKO_005 807 3UTR 100% 10.800 7.560 N Rab6b n/a
7 TRCN0000048091 CAAAGAACTGAGCGTCATGTT pLKO.1 438 CDS 100% 4.950 3.465 N RAB6B n/a
8 TRCN0000380614 CCAAAGAACTGAGCGTCATGT pLKO_005 437 CDS 100% 4.950 3.465 N RAB6B n/a
9 TRCN0000100904 GCTGTGGTGGTATATGACATT pLKO.1 268 CDS 100% 4.950 3.465 N Rab6b n/a
10 TRCN0000100902 CCAGCAGACTTCTAAATGGAT pLKO.1 306 CDS 100% 3.000 2.100 N Rab6b n/a
11 TRCN0000100901 CGGGATTGACTTCTTGTCAAA pLKO.1 141 CDS 100% 0.495 0.347 N Rab6b n/a
12 TRCN0000100900 CCACAGTCAAATCCAACTTTA pLKO.1 1180 3UTR 100% 13.200 7.920 N Rab6b n/a
13 TRCN0000381769 GGCAGATAACCATCGAGGAGG pLKO_005 404 CDS 100% 0.720 0.504 N RAB6B n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4236 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08317 pDONR223 100% 85.1% 88.2% None (many diffs) n/a
2 ccsbBroad304_08317 pLX_304 0% 85.1% 88.2% V5 (many diffs) n/a
3 TRCN0000478941 CGCCTGTGGTATCCAGTCTTTGCT pLX_317 49.8% 85.1% 88.2% V5 (many diffs) n/a
Download CSV