Construct: ORF TRCN0000478954
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017178.1_s317c1
- Derived from:
- ccsbBroadEn_09461
- DNA Barcode:
- CTGTATGTTGCACAAAACACTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CLRN3 (119467)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478954
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 119467 | CLRN3 | clarin 3 | NM_152311.5 | 99.8% | 100% | 111A>G |
| 2 | human | 119467 | CLRN3 | clarin 3 | XM_011539274.2 | 73.3% | 73.4% | 111A>G;228_229ins180 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 744
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc taccacaaag aagacattga tgttcttatc aagctttttc accagccttg 121 ggtccttcat tgtaatttgc tctattcttg ggacacaagc atggatcacc agtacgattg 181 ctgttagaga ctctgcttca aatgggagca ttttcatcac ttacggactt tttcgtgggg 241 agagtagtga agaattgagt cacggacttg cagaaccaaa gaaaaagttt gcagttttag 301 agatactgaa taattcttcc caaaaaactc tgcattcggt gactatcctg ttcctggtcc 361 tgagtttgat cacgtcgctg ctgagctctg ggtttaccTT CTACAACAGC ATCAGCAACC 421 CTTACCAGAC ATTCCTGGGG CCGACGGGGG TGTACACCTG GAACGGGCTC GGTGCATCCT 481 TCGTTTTTGT GACCATGATA CTGTTTGTGG CGAACACGCA GTCCAACCAA CTCTCCGAAG 541 AGTTGTTCCA AATGCTTTAC CCGGCAACCA CCAGTAAAGG AACGACCCAC AGTTACGGAT 601 ACTCGTTCTG GCTCATACTG CTCGTCATTC TTCTAAATAT AGTCACTGTA ACCATCATCA 661 TTTTCTACCA GAAGGCCAGA TACCAGCGGA AGCAGGAGCA GAGAAAGCCA ATGGAATATG 721 CTCCAAGGGA CGGAATTTTA TTCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TGTATGTTGC 901 ACAAAACACT GTCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att