Transcript: Human NM_152311.5

Homo sapiens clarin 3 (CLRN3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CLRN3 (119467)
Length:
1146
CDS:
158..838

Additional Resources:

NCBI RefSeq record:
NM_152311.5
NBCI Gene record:
CLRN3 (119467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152311.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167745 GCTCGTCATTCTTCTAAATAT pLKO.1 712 CDS 100% 15.000 21.000 N CLRN3 n/a
2 TRCN0000167926 CTGCTTCAAATGGGAGCATTT pLKO.1 285 CDS 100% 1.080 1.512 N CLRN3 n/a
3 TRCN0000421165 ACTCTGCATTCGGTGACTATC pLKO_005 419 CDS 100% 10.800 8.640 N CLRN3 n/a
4 TRCN0000168764 GCAGAGAAAGCCAATGGAATA pLKO.1 790 CDS 100% 10.800 7.560 N CLRN3 n/a
5 TRCN0000420390 TCATTGTAATTTGCTCTATTC pLKO_005 219 CDS 100% 10.800 7.560 N CLRN3 n/a
6 TRCN0000172713 GCCCTGAGTAGTAACTGGTTA pLKO.1 882 3UTR 100% 4.950 3.465 N CLRN3 n/a
7 TRCN0000126212 CAACAGCATCAGCAACCCTTA pLKO.1 496 CDS 100% 4.050 2.835 N Clrn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152311.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09461 pDONR223 100% 99.8% 100% None 111A>G n/a
2 ccsbBroad304_09461 pLX_304 0% 99.8% 100% V5 111A>G n/a
3 TRCN0000478954 CTGTATGTTGCACAAAACACTGTC pLX_317 51% 99.8% 100% V5 111A>G n/a
Download CSV