Construct: ORF TRCN0000478993
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016610.1_s317c1
- Derived from:
- ccsbBroadEn_03266
- DNA Barcode:
- CCACCGCATCGTCGGCTTTGCGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ERGIC2 (51290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478993
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51290 | ERGIC2 | ERGIC and golgi 2 | NM_016570.3 | 100% | 100% | |
| 2 | human | 51290 | ERGIC2 | ERGIC and golgi 2 | XM_024449009.1 | 100% | 100% | |
| 3 | human | 51290 | ERGIC2 | ERGIC and golgi 2 | XR_001748740.2 | 24.4% | 1_82del;1214_4620del | |
| 4 | human | 51290 | ERGIC2 | ERGIC and golgi 2 | XR_001748741.2 | 22.6% | 1_82del;1214_4985del | |
| 5 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | NM_026168.4 | 91.4% | 95.4% | (many diffs) |
| 6 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_006507087.2 | 91.4% | 95.4% | (many diffs) |
| 7 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_017321716.1 | 91.4% | 95.4% | (many diffs) |
| 8 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_006507089.3 | 88.8% | 92.5% | (many diffs) |
| 9 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_017321717.1 | 71.3% | 70.1% | (many diffs) |
| 10 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | NM_001286560.1 | 71.3% | 74% | (many diffs) |
| 11 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_011241623.2 | 68.8% | 67.2% | (many diffs) |
| 12 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XR_001785162.1 | 63.3% | (many diffs) | |
| 13 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XM_017321718.1 | 51.8% | 48.5% | (many diffs) |
| 14 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XR_378169.3 | 32% | (many diffs) | |
| 15 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XR_001785161.1 | 31.1% | (many diffs) | |
| 16 | mouse | 67456 | Ergic2 | ERGIC and golgi 2 | XR_378170.3 | 22.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gcgactgaat cggaaaaaaa ctttaagttt ggtaaaagag ttggatgcct 121 ttccgaaggt tcctgagagc tatgtagaga cttcagccag tggaggtaca gtttctctaa 181 tagcatttac aactatggct ttattaacca taatggaatt ctcagtatat caagatacat 241 ggatgaagta tgaatacgaa gtagacaagg atttttctag caaattaaga attaatatag 301 atattactgt tgccatgaag tgtcaatatg ttggagcgga tgtattggat ttagcagaaa 361 caatggttgc atctgcagat ggtttagttt atgaaccaac agtatttgat ctttcaccac 421 agcagaaaga gtggcagagg atgctgcagc tgattcagag taggctacaa gaagagcatt 481 cacttcaaga tgtgatattt aaaagtgctt ttaaaagtac atcaacagct cttccaccaa 541 gagaagatga ttcatcacag tctccaaatg catgcagaat tcatggccat ctatatgtca 601 ataaagtagc agggaatttt cacataacag tgggcaaggc aattccacat cctcgtggtc 661 atgcacattt ggcagcactt gtcaaccatg aatcttacaa tttttctcat agaatagatc 721 atttgtcttt tGGAGAGCTT GTTCCAGCAA TTATTAATCC TTTAGATGGA ACTGAAAAAA 781 TTGCTATAGA TCACAACCAG ATGTTCCAAT ATTTTATTAC AGTTGTGCCA ACAAAACTAC 841 ATACATATAA AATATCAGCA GACACCCATC AGTTTTCTGT GACAGAAAGG GAACGTATCA 901 TTAACCATGC TGCAGGCAGC CATGGAGTCT CTGGGATATT TATGAAATAT GATCTCAGTT 961 CTCTTATGGT GACAGTTACT GAGGAGCACA TGCCATTCTG GCAGTTTTTT GTAAGACTCT 1021 GTGGTATTGT TGGAGGAATC TTTTCAACAA CAGGCATGTT ACATGGAATT GGAAAATTTA 1081 TAGTTGAAAT AATTTGCTGT CGTTTCAGAC TTGGATCCTA TAAACCTGTC AATTCTGTTC 1141 CTTTTGAGGA TGGCCACACA GACAACCACT TACCTCTTTT AGAAAATAAT ACACATTACC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GACCACCGCA TCGTCGGCTT TGCGTGACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt