Transcript: Mouse XM_011241623.2

PREDICTED: Mus musculus ERGIC and golgi 2 (Ergic2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ergic2 (67456)
Length:
1876
CDS:
122..1000

Additional Resources:

NCBI RefSeq record:
XM_011241623.2
NBCI Gene record:
Ergic2 (67456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256711 ACATGGATGAAGTACGAATAT pLKO_005 293 CDS 100% 13.200 18.480 N Ergic2 n/a
2 TRCN0000256710 TTCCCTTCAAGACGTGATATT pLKO_005 535 CDS 100% 13.200 18.480 N Ergic2 n/a
3 TRCN0000029700 GTCAATAAAGTAGCAGGGAAT pLKO.1 653 CDS 100% 4.050 5.670 N ERGIC2 n/a
4 TRCN0000196054 GCAGATGGTCTGGCTTATGAA pLKO.1 431 CDS 100% 5.625 4.500 N Ergic2 n/a
5 TRCN0000196115 GAGAGCTTGTTCCGGGAATTA pLKO.1 789 CDS 100% 13.200 9.240 N Ergic2 n/a
6 TRCN0000256709 TGCGAATCAACATAGACATTA pLKO_005 342 CDS 100% 13.200 9.240 N Ergic2 n/a
7 TRCN0000183309 GTGAAAGAGTTAGATGCCTTT pLKO.1 158 CDS 100% 4.050 2.835 N Ergic2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03266 pDONR223 100% 68.8% 67.2% None (many diffs) n/a
2 ccsbBroad304_03266 pLX_304 0% 68.8% 67.2% V5 (many diffs) n/a
3 TRCN0000478993 CCACCGCATCGTCGGCTTTGCGTG pLX_317 41.3% 68.8% 67.2% V5 (many diffs) n/a
4 ccsbBroadEn_11970 pDONR223 100% 66.3% 63.3% None (many diffs) n/a
5 ccsbBroad304_11970 pLX_304 0% 66.3% 63.3% V5 (many diffs) n/a
6 TRCN0000474566 CGAAATGTGACATTCACGCAGCCG pLX_317 73.5% 66.2% 24.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV