Construct: ORF TRCN0000479020
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011666.1_s317c1
- Derived from:
- ccsbBroadEn_06301
- DNA Barcode:
- AGTAAGCTTTTATCGCGCTTCCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GOT2 (2806)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479020
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2806 | GOT2 | glutamic-oxaloacetic transa... | NM_002080.4 | 99.9% | 99.7% | 1283T>C |
| 2 | human | 2806 | GOT2 | glutamic-oxaloacetic transa... | NM_001286220.2 | 89.9% | 89.7% | 245_246ins129;1154T>C |
| 3 | mouse | 14719 | Got2 | glutamatic-oxaloacetic tran... | NM_010325.2 | 88.6% | 94.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1356
- ORF length:
- 1290
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cctgctgcac tccggccgcg tcctccccgg gatcgccgcc gccttccacc 121 cgggcctcgc cgccgcggcc tctgccagag ccagctcctg gtggacccat gtggaaatgg 181 gacctccaga tcccattctg ggagtcactg aagcctttaa gagggacacc aatagcaaaa 241 agatgaatct gggagttggt gcctaccggg atgataatgg aaagccttac gttctgccta 301 gcgtccgcaa ggcagaggcc cagattgccg caaaaaattt ggacaaggaa tacctgccca 361 ttgggggact ggctgaattt tgcaaggcat ctgcagaact agccctgggt gagaacagcg 421 aagtcttgaa gagtggccgg tttgtcactg tgcagaccat ttctggaact ggagccttaa 481 ggatcggagc cagttttctg caaagatttt ttaagttcag ccgagatgtc tttctgccca 541 aaccaacctg gggaaaccac acacccatct tcagggatgc tggcatgcag ctacaaggtt 601 atcggtatta tgaccccaag acttgcggtt ttgacttcac aggcgctgtg gaggatattt 661 caaaaatacc agagcagagt gttcttcttc tgcatgcctg cgcccacaat cccacgggag 721 tggacccgcg tccggaacag tggaaggaaa tagcaacagt ggtgaagaaa aggaatctct 781 ttgcgttctt tgacatggcc taccaaggct ttgccagtgg tgatggtgat aaggatgcct 841 gggctgtgcg ccacttcatc gaacagggca ttaatgtttg cctctgccaa tcatatgcca 901 agaacatggg cttatatggt gagcgtgtag gagccttcac tatggtctgc aaagatgcgg 961 atgaagccaa aagggtagag tcacagttGA AGATCTTGAT CCGTCCCATG TATTCCAACC 1021 CTCCCCTCAA TGGGGCCCGG ATTGCTGCTG CCATTCTGAA CACCCCAGAT TTGCGAAAAC 1081 AATGGCTGCA AGAAGTGAAA GTCATGGCTG ACCGCATCAT TGGCATGCGG ACTCAACTGG 1141 TCTCCAACCT CAAGAAGGAG GGTTCCACCC ACAATTGGCA ACACATCACC GACCAAATTG 1201 GCATGTTCTG TTTCACAGGG CTAAAGCCTG AACAGGTGGA GCGGCTGATC AAGGAGTTCT 1261 CCATCTACAT GACAAAAGAT GGCCGCATCT CTGTGGCAGG GGTCACCTCC AGCAACGTGG 1321 GCTACCTTGC CCATGCCATT CACCAGGCCA CCAAGTACCC AACTTTCTTG TACAAAGTGG 1381 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1441 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1501 AAGTAAGCTT TTATCGCGCT TCCACACGCG TTAAGTCgac aatcaacctc tggattacaa 1561 aatttgtgaa agatt