Transcript: Mouse NM_010325.2

Mus musculus glutamatic-oxaloacetic transaminase 2, mitochondrial (Got2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Got2 (14719)
Length:
2345
CDS:
61..1353

Additional Resources:

NCBI RefSeq record:
NM_010325.2
NBCI Gene record:
Got2 (14719)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119801 GAGCCCTAGAAGACATATCAA pLKO.1 638 CDS 100% 5.625 7.875 N Got2 n/a
2 TRCN0000325946 GAGCCCTAGAAGACATATCAA pLKO_005 638 CDS 100% 5.625 7.875 N Got2 n/a
3 TRCN0000119800 CCAATCGTATGCCAAGAACAT pLKO.1 882 CDS 100% 4.950 6.930 N Got2 n/a
4 TRCN0000119798 GCTCCAAGGTTATCGCTACTA pLKO.1 585 CDS 100% 4.950 6.930 N Got2 n/a
5 TRCN0000325948 GCTCCAAGGTTATCGCTACTA pLKO_005 585 CDS 100% 4.950 6.930 N Got2 n/a
6 TRCN0000119797 GCAGACCACATTACAGAAATT pLKO.1 1814 3UTR 100% 13.200 9.240 N Got2 n/a
7 TRCN0000326020 GCAGACCACATTACAGAAATT pLKO_005 1814 3UTR 100% 13.200 9.240 N Got2 n/a
8 TRCN0000119799 GTTCTGTTTCACCGGCCTAAA pLKO.1 1200 CDS 100% 10.800 7.560 N Got2 n/a
9 TRCN0000326018 GTTCTGTTTCACCGGCCTAAA pLKO_005 1200 CDS 100% 10.800 7.560 N Got2 n/a
10 TRCN0000034825 CGAGATGTCTTTCTGCCCAAA pLKO.1 517 CDS 100% 4.050 2.835 N GOT2 n/a
11 TRCN0000291988 CGAGATGTCTTTCTGCCCAAA pLKO_005 517 CDS 100% 4.050 2.835 N GOT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06301 pDONR223 100% 88.6% 94.4% None (many diffs) n/a
2 ccsbBroad304_06301 pLX_304 0% 88.6% 94.4% V5 (many diffs) n/a
3 TRCN0000479020 AGTAAGCTTTTATCGCGCTTCCAC pLX_317 28.8% 88.6% 94.4% V5 (many diffs) n/a
Download CSV