Construct: ORF TRCN0000479038
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002142.1_s317c1
- Derived from:
- ccsbBroadEn_11489
- DNA Barcode:
- TTCGATGCGACTCCCTATGCGATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPM2 (10361)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479038
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | NM_001286681.1 | 100% | 100% | |
| 2 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | NM_001286680.2 | 63.5% | 57.4% | 364_530del;576_642del |
| 3 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | NM_182795.1 | 63.5% | 57.4% | 364_530del;576_642del |
| 4 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_011544362.2 | 63.5% | 57.4% | 364_530del;576_642del |
| 5 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_011544363.2 | 63.5% | 57.4% | 364_530del;576_642del |
| 6 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_017012948.2 | 63.5% | 57.4% | 364_530del;576_642del |
| 7 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_017012949.2 | 63.5% | 57.4% | 364_530del;576_642del |
| 8 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_024447051.1 | 63.5% | 57.4% | 364_530del;576_642del |
| 9 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_017012950.2 | 43.9% | 37.8% | 143_144ins126;238_404del;450_516del |
| 10 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_011544360.2 | 43.5% | 37% | (many diffs) |
| 11 | human | 10361 | NPM2 | nucleophosmin/nucleoplasmin 2 | XM_011544364.3 | 36.4% | 30.3% | 0_1ins174;190_356del;402_468del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 474
- ORF length:
- 408
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tctcagtagc gccagtagca cggaggaaaa ggcagtgacg accgtgctct 121 ggggctgcga gctcagtcag gagaggcgga cttggacctt cagaccccag ctggagggga 181 agcagagctg caggctgttg cttcatacga tttgcttggg ggagaaagcc aaagaggaga 241 tgcatcgcgt ggagatcctg cccccagcaa accaggagga caagaagatg cagccggtca 301 ccattgcctc actccaggcc TCAGTCCTCC CCATGGTCTC CATGGTAGGA GTGCAGCTTT 361 CTCCCCCAGT TACTTTCCAG CTCCGGGCTG GCTCAGGACC CGTGTTCCTC AGTGGCCAGG 421 AACGTTATGA AAAAAAAGCT GGAAAAAGAA GAAGAGGAAA TAAGAGCCAG CGTTACCCAA 481 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 541 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 601 TATCTTGTGG AAAGGACGAT TCGATGCGAC TCCCTATGCG ATTACGCGTT AAGTCgacaa 661 tcaacctctg gattacaaaa tttgtgaaag att