Transcript: Human XM_017012950.2

PREDICTED: Homo sapiens nucleophosmin/nucleoplasmin 2 (NPM2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPM2 (10361)
Length:
1594
CDS:
850..1368

Additional Resources:

NCBI RefSeq record:
XM_017012950.2
NBCI Gene record:
NPM2 (10361)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154167 CGTTATGAAGCATCAGACCTA pLKO.1 1081 CDS 100% 2.640 3.696 N NPM2 n/a
2 TRCN0000150854 GTTATGAAGCATCAGACCTAA pLKO.1 1082 CDS 100% 4.950 3.465 N NPM2 n/a
3 TRCN0000156884 GAGGAAATAAGAGCCAGCGTT pLKO.1 1279 CDS 100% 2.640 1.848 N NPM2 n/a
4 TRCN0000153371 GATATATCTCTGGAGGAGCAA pLKO.1 1177 CDS 100% 2.640 1.848 N NPM2 n/a
5 TRCN0000153370 GAGGATGAGGATGCAGATATA pLKO.1 1162 CDS 100% 13.200 7.920 N NPM2 n/a
6 TRCN0000156844 GATGAGGATGAGGATGCAGAT pLKO.1 1159 CDS 100% 4.050 2.430 N NPM2 n/a
7 TRCN0000153398 GAAGAGGAAGATGATGAGGAT pLKO.1 1147 CDS 100% 2.640 1.584 N NPM2 n/a
8 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 1141 CDS 100% 4.950 2.475 Y NPM2 n/a
9 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 1138 CDS 100% 4.950 2.475 Y NPM2 n/a
10 TRCN0000158207 CAGGCTGTTGCTTCATACGAT pLKO.1 975 CDS 100% 3.000 2.400 N NPM2 n/a
11 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1136 CDS 100% 4.950 2.475 Y Adam32 n/a
12 TRCN0000420925 GATGATGAGGATGAGGATGAT pLKO_005 1156 CDS 100% 4.950 2.475 Y TAF7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11489 pDONR223 100% 43.9% 37.8% None 143_144ins126;238_404del;450_516del n/a
2 ccsbBroad304_11489 pLX_304 0% 43.9% 37.8% V5 143_144ins126;238_404del;450_516del n/a
3 TRCN0000479038 TTCGATGCGACTCCCTATGCGATT pLX_317 38.3% 43.9% 37.8% V5 143_144ins126;238_404del;450_516del n/a
Download CSV