Construct: ORF TRCN0000479170
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002182.2_s317c1
- Derived from:
- ccsbBroadEn_12355
- DNA Barcode:
- TCAAGCACCTGCGTTGCCCATAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- XPO5 (57510)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479170
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57510 | XPO5 | exportin 5 | NM_020750.3 | 23.2% | 23.2% | 1_2772del |
2 | human | 57510 | XPO5 | exportin 5 | NR_144392.1 | 15.2% | 1_3121del;3962_5502del | |
3 | mouse | 72322 | Xpo5 | exportin 5 | NM_028198.3 | 20% | 20.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 906
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gctttctcag aaatggcaag ttatcaacca aaggagcctg ctgtgtggag 121 aagatgaggc tgcagatgaa aacccagagt ctcaagagat gctggaggag caactggtga 181 ggatgttaac ccgagaagtc atggacctaa tcacggtttg ctgtgtttca aagaagggtg 241 ctgaccacag tagtgctccc ccagcagatg gagacgatga agaaatgatg gccacagagg 301 tcaccccctc agctatggca gagcttacag acctgggcaa atgtctgatg aagcatgagg 361 atgtttgtac agcgctatta attacagcct tcaattccct ggcctggaaa gatactctgt 421 cctgccagag gacaacctca cagcTCTGCT GGCCTCTCCT CAAACAAGTG CTGTCAGGGA 481 CACTGCTCGC AGATGCAGTT ACGTGGCTTT TCACCAGTGT GCTGAAAGGC TTACAGATGC 541 ACGGGCAGCA CGACGGGTGC ATGGCTTCCC TGGTCCATCT GGCCTTCCAG ATATACGAGG 601 CACTGCGCCC CAGGTACCTG GAGATAAGAG CTGTAATGGA GCAAATCCCT GAAATACAGA 661 AGGACTCACT GGACCAGTTT GACTGCAAGC TTTTAAACCC CTCCCTGCAG AAAGTGGCTG 721 ACAAGCGCCG AAAGGACCAA TTCAAACGCC TCATTGCTGG TTGCATTGGG AAACCCTTGG 781 GAGAGCAGTT CCGAAAAGAA GTTCACATTA AGAATCTTCC CTCACTTTTC AAAAAAACAA 841 AGCCAATGCT GGAGACGGAG GTGCTGGACA ATGATGGGGG TGGCCTGGCC ACCATCTTTG 901 AACCCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCAAGCACC TGCGTTGCCC ATAGTACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt