Construct: ORF TRCN0000479421
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007441.1_s317c1
- Derived from:
- ccsbBroadEn_01864
- DNA Barcode:
- TAAGTCAAACTCAGAGCCATCCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR68 (8111)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479421
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268110.4 | 100% | 100% | |
2 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268111.3 | 100% | 100% | |
3 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268112.3 | 100% | 100% | |
4 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_006720262.3 | 100% | 100% | |
5 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537196.2 | 100% | 100% | |
6 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537197.3 | 100% | 100% | |
7 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537198.2 | 100% | 100% | |
8 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537199.2 | 100% | 100% | |
9 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001177676.2 | 97.3% | 97.3% | 0_1ins30 |
10 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001348437.1 | 97.3% | 97.3% | 0_1ins30 |
11 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_003485.3 | 97.3% | 97.3% | 0_1ins30 |
12 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | XM_017315062.1 | 87.6% | 91.7% | (many diffs) |
13 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177673.1 | 85.4% | 89.6% | (many diffs) |
14 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177674.1 | 85.4% | 89.6% | (many diffs) |
15 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_175493.4 | 85.4% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1194
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaggagtgtg gccccttcag gcccaaagat ggggaacatc actgcagaca 121 actcctcgat gagctgtacc atcgaccata ccatccacca gacgctggcc ccggtggtct 181 atgttaccgt gctggtggtg ggcttcccgg ccaactgcct gtccctctac ttcggctacc 241 tgcagatcaa ggcccggaac gagctgggcg tgtacctgtg caacctgacg gtggccgacc 301 tcttctacat ctgctcgctg cccttctggc tgcagtacgt gctgcagcac gacaactggt 361 ctcacggcga cctgtcctgc caggtgtgcg gcatcctcct gtacgagaac atctacatca 421 gcgtgggctt cctctgctgc atctccgtgg accgctacct ggctgtggcc catcccttcc 481 gcttccacca gttccggacc ctgaaggcgg ccgtcggcgt cagcgtggtc atctgggcca 541 aggagctgct gaccagcatc tacttcctga tgcacgagga ggtcatcgag gacgagaacc 601 agcaccgcgt gtgctttgag cactacccca tccaggcatg gcagcgcgcc atcaactact 661 accgcttcct ggtgggcttc ctcttcccca tctgcctgct gctggcgtcc taccagggca 721 tcctgcgcgc cgtgcgccgg agccacggca cccagaagag ccgcaaggac cagatccagc 781 ggctggtgct cagcaccgtg gtcatcttcc tggcctgctt cctgccctac cacgtgttgc 841 tgctggtgcg cagcgtctgg gaggccagct gcgacttcgc caagggcgtt ttcaacgcct 901 accacttctc ccTCCTGCTC ACCAGCTTCA ACTGCGTCGC CGACCCCGTG CTCTACTGCT 961 TCGTCAGCGA GACCACCCAC CGGGACCTGG CCCGCCTCCG CGGGGCCTGC CTGGCCTTCC 1021 TCACCTGCTC CAGGACCGGC CGGGCCAGGG AGGCCTACCC GCTGGGTGCC CCCGAGGCCT 1081 CCGGGAAAAG CGGGGCCCAG GGTGAGGAGC CCGAGCTGTT GACCAAGCTC CACCCGGCCT 1141 TCCAGACCCC TAACTCGCCA GGGTCGGGCG GGTTCCCCAC GGGCAGGTTG GCCTTGCCAA 1201 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1261 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1321 TATCTTGTGG AAAGGACGAT AAGTCAAACT CAGAGCCATC CTGACGCGTT AAGTCgacaa 1381 tcaacctctg gattacaaaa tttgtgaaag att