Transcript: Mouse NM_001177673.1

Mus musculus G protein-coupled receptor 68 (Gpr68), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gpr68 (238377)
Length:
2938
CDS:
319..1416

Additional Resources:

NCBI RefSeq record:
NM_001177673.1
NBCI Gene record:
Gpr68 (238377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026108 GCGAGGAACCTGAATTGTTAA pLKO.1 1322 CDS 100% 13.200 18.480 N Gpr68 n/a
2 TRCN0000026087 CCTCAATCACAAGGAGGTCAT pLKO.1 786 CDS 100% 4.050 5.670 N Gpr68 n/a
3 TRCN0000026086 CCTCCTCTATGAGAACATTTA pLKO.1 615 CDS 100% 13.200 9.240 N Gpr68 n/a
4 TRCN0000026106 CTTCGGGTACTTGCAGATCAA pLKO.1 450 CDS 100% 4.950 3.465 N Gpr68 n/a
5 TRCN0000026080 GCAGCGTAGCATCAACTACTA pLKO.1 861 CDS 100% 4.950 3.465 N Gpr68 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2537 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01864 pDONR223 100% 85.4% 89.6% None (many diffs) n/a
2 ccsbBroad304_01864 pLX_304 0% 85.4% 89.6% V5 (many diffs) n/a
3 TRCN0000479421 TAAGTCAAACTCAGAGCCATCCTG pLX_317 25.4% 85.4% 89.6% V5 (many diffs) n/a
4 TRCN0000489192 CAGACTCAAGACCTCGCGACTGTT pLX_317 32.6% 85.4% 89.6% V5 (many diffs) n/a
5 TRCN0000487723 GGTATGATACCTGAGACCCTTGGC pLX_317 25.5% 85.4% 89.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_11254 pDONR223 100% 80% 84.5% None (many diffs) n/a
7 ccsbBroad304_11254 pLX_304 0% 80% 84.5% V5 (many diffs) n/a
8 TRCN0000480497 TGCTCGCCGAATCACACCCGTATC pLX_317 36.4% 80% 84.5% V5 (many diffs) n/a
Download CSV