Construct: ORF TRCN0000479435
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006094.1_s317c1
- Derived from:
- ccsbBroadEn_05229
- DNA Barcode:
- GGCTCAGACATCCTATTTACAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TBATA (219793)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479435
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 219793 | TBATA | thymus, brain and testes as... | NM_001318242.2 | 99.9% | 99.7% | 710G>A |
| 2 | human | 219793 | TBATA | thymus, brain and testes as... | NM_152710.4 | 99.9% | 99.7% | 710G>A |
| 3 | human | 219793 | TBATA | thymus, brain and testes as... | NM_001318241.1 | 99.6% | 99.4% | 506_508delAGC;713G>A |
| 4 | human | 219793 | TBATA | thymus, brain and testes as... | NM_001318243.2 | 99.6% | 99.4% | 426_427insGAA;707G>A |
| 5 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015853.1 | 91.5% | 91.3% | 506_601del;806G>A |
| 6 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015856.1 | 87% | 85% | (many diffs) |
| 7 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015857.1 | 85.1% | 84.3% | (many diffs) |
| 8 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015849.1 | 83.8% | 75.1% | (many diffs) |
| 9 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015855.1 | 82.9% | 80.2% | (many diffs) |
| 10 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015854.1 | 81.6% | 79.6% | (many diffs) |
| 11 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015848.1 | 80.7% | 71.5% | (many diffs) |
| 12 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015852.1 | 79.7% | 74.8% | (many diffs) |
| 13 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015845.1 | 76.9% | 68.9% | (many diffs) |
| 14 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015846.1 | 76.9% | 69.4% | (many diffs) |
| 15 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015847.1 | 74.5% | 71.3% | (many diffs) |
| 16 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015858.1 | 72.7% | 63.3% | (many diffs) |
| 17 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015859.2 | 72.7% | 63.3% | (many diffs) |
| 18 | human | 219793 | TBATA | thymus, brain and testes as... | NR_134532.1 | 66.7% | (many diffs) | |
| 19 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015860.1 | 65.9% | 60.7% | 506_601del;785_786ins227;923_1026del |
| 20 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015861.2 | 65.2% | 61.7% | 506_601del;785_786ins82;846_847ins221 |
| 21 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015850.1 | 64.4% | 57.8% | (many diffs) |
| 22 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015851.1 | 64.2% | 57.6% | (many diffs) |
| 23 | human | 219793 | TBATA | thymus, brain and testes as... | NR_134531.2 | 62.2% | 1_366del;1055_1056ins82;1338_1478del | |
| 24 | human | 219793 | TBATA | thymus, brain and testes as... | XR_002956967.1 | 61.1% | (many diffs) | |
| 25 | human | 219793 | TBATA | thymus, brain and testes as... | XR_001747054.1 | 60.4% | (many diffs) | |
| 26 | human | 219793 | TBATA | thymus, brain and testes as... | XR_001747055.1 | 58.8% | (many diffs) | |
| 27 | human | 219793 | TBATA | thymus, brain and testes as... | XM_017015862.1 | 58.2% | 47.6% | 506_563del;705_706ins406 |
| 28 | human | 219793 | TBATA | thymus, brain and testes as... | XR_001747057.1 | 57.8% | (many diffs) | |
| 29 | human | 219793 | TBATA | thymus, brain and testes as... | NR_134533.1 | 57.5% | (many diffs) | |
| 30 | human | 219793 | TBATA | thymus, brain and testes as... | XR_001747056.1 | 56.4% | (many diffs) | |
| 31 | human | 219793 | TBATA | thymus, brain and testes as... | NR_134534.1 | 52.1% | (many diffs) | |
| 32 | human | 219793 | TBATA | thymus, brain and testes as... | XR_001747058.1 | 36.5% | 1_390del;896_1089del;1182_1183ins455 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1122
- ORF length:
- 1053
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctacagat gttcaattgg ctgattatcc actgatgagt ccaaaggctg 121 agctgaaact ggagaagaag tcagggcgca agccaaggag ccccagggac agtgggccac 181 agaaagaact ggtgatccca gggattgtgg atttcgagcg gatccgccgg gcattgagga 241 ccccaaagcc ccaaacccct ggcacctact gctttggacg cctcagtcac cactccttct 301 tctcccggca ccacccacac ccccagcacg tgacccacat ccaagatctc accgggaagc 361 ctgtctgtgt cgtcagggat tttccagccc ccttgcctga gtcaactgtc ttttccggct 421 gtcaaatggg gatacccacc atctctgtcc ccattggaga cccacagtct aatcggaacc 481 cccagctttc ttctgaagcc tggaagaagg agttgaagga gctagcttcc cgggtggcct 541 tcctcaccaa ggaggatgaa ctgaagaaga aagagaagga gcagaaggag gagcctctgc 601 gggagcaggg ggcaaagtac tcagcagaga ctgggaggct catccccgct tccacccggg 661 ctgtcggccg ccgcagatct caccagggcc agcagagtca gtcttccagc agacatgaag 721 gagtccaggc tttcctcctt caggatcagg agctgctggt cctggagctc ctgtgtcaga 781 tcctggaaac agacttgcta agcgcaatcc agttctggct gctctacgcT CCGCCCAAGG 841 AAAAAGACCT CGCTCTGGGA CTCCTGCAGA CAGCAGTGGC TCAGCTCCTT CCCCAGCCCC 901 TAGTCTCCAT CCCTACAGAA AAGCTCCTAA GCCAGCTTCC AGAAGTGCAT GAACCTCCTC 961 AAGAGAAGCA AGAGCCACCC TGCAGTCAAT CCCCGAAGAA AACGAAGATA TCACCTTTTA 1021 CAAAAAGCGA AAAACCAGAG TACATTGGAG AAGCTCAAGT CCTCCAGATG CATTCAAGCC 1081 AGAACACAGA GAAGAAGACA TCGAAGCCGA GGGCAGAGAG CTTGCCAACT TTCTTGTACA 1141 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1201 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1261 AGGACGAGGC TCAGACATCC TATTTACAAA TACGCGTTAA GTCgacaatc aacctctgga 1321 ttacaaaatt tgtgaaagat t