Transcript: Human XM_017015861.2

PREDICTED: Homo sapiens thymus, brain and testes associated (TBATA), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBATA (219793)
Length:
1332
CDS:
391..1239

Additional Resources:

NCBI RefSeq record:
XM_017015861.2
NBCI Gene record:
TBATA (219793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434032 CACGTGACCCACATCCAAGAT pLKO_005 649 CDS 100% 4.950 6.930 N TBATA n/a
2 TRCN0000427704 CTCAGTCACCACTCCTTCTTC pLKO_005 604 CDS 100% 4.950 3.465 N TBATA n/a
3 TRCN0000136545 CTTGCCTGAGTCAACTGTCTT pLKO.1 714 CDS 100% 4.950 3.465 N TBATA n/a
4 TRCN0000162866 GAAGTGCATGAACCTCCTCAA pLKO.1 1278 3UTR 100% 4.050 2.835 N TBATA n/a
5 TRCN0000164219 CAGAAAGAACTGGTGATCCCA pLKO.1 502 CDS 100% 0.750 0.525 N TBATA n/a
6 TRCN0000160712 CAAGGAGGATGAACTGAAGAA pLKO.1 870 CDS 100% 4.950 2.970 N TBATA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05229 pDONR223 100% 65.2% 61.7% None 506_601del;785_786ins82;846_847ins221 n/a
2 ccsbBroad304_05229 pLX_304 0% 65.2% 61.7% V5 506_601del;785_786ins82;846_847ins221 n/a
3 TRCN0000479435 GGCTCAGACATCCTATTTACAAAT pLX_317 28.1% 65.2% 61.7% V5 506_601del;785_786ins82;846_847ins221 n/a
Download CSV