Construct: ORF TRCN0000479517
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001718.1_s317c1
- Derived from:
- ccsbBroadEn_05727
- DNA Barcode:
- CTAACTTAACGATATTTTCATATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM236 (653567)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479517
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 653567 | TMEM236 | transmembrane protein 236 | NM_001098844.3 | 100% | 100% | |
| 2 | human | 653567 | TMEM236 | transmembrane protein 236 | XM_017016574.1 | 79.1% | 76.3% | (many diffs) |
| 3 | human | 653567 | TMEM236 | transmembrane protein 236 | XM_011519627.2 | 74.3% | 74.3% | 0_1ins270 |
| 4 | human | 653567 | TMEM236 | transmembrane protein 236 | XM_011519626.2 | 74.2% | 71.7% | (many diffs) |
| 5 | human | 653567 | TMEM236 | transmembrane protein 236 | XM_011519628.1 | 68.7% | 68.6% | 0_1ins328;2delT |
| 6 | human | 653567 | TMEM236 | transmembrane protein 236 | XM_011519629.1 | 64.6% | 64.6% | 0_1ins372 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1122
- ORF length:
- 1053
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcttctgga aggctcatta agttcgtggt ttttgagctc ctagagtttg 121 ccgctttctc catccccaca ctcgtgatca cagaacagtt tgccaccgcc taccaaggaa 181 caagggctag atctgacaac acacactact ggctgatcat ctcctgttct attgcctatg 241 ttgcgttagt gactctactg atctgggttc ctgtaaaagt tatcctgcac aagaaacgtt 301 atatttacag aaaaattaaa ggatggagac ctgttctgat gatgtgtgtg gtcctcacca 361 cactgccctg cctcaccttt tccatagcag tgactgaggt tcaaaagagc attaatgggt 421 ccgctgatgt cttacctgat atgttacctg acctgcccgt atctctggtt ctgttatccc 481 tgatcatggt tgatattatt gaaaaactca ggatatatcc tcttagaggg agtcaaaaga 541 gtagtgaaaa tggacacatc cattcaacct ctttgcaaca cataaaaact gtgacggagc 601 aagtgaggca aagtccagaa aacgctgcat ctccccaggc aaccaacagc acccaggtgt 661 cgcagccatc aggagccatg acacggagcc aggagtctgt gttcatggga ccccaggagc 721 cctcctgtga ctccggaatc ctgagaatga tgtcccggcg agatgtccgg gcagagttat 781 tcttatggag ctttctcctg tggTCTGACA CGATAGAAAT GGTGCGTGTG GCTGGTCACC 841 CCAACGTGTA CAAGTCAAGC TGGCTATACC CAGTCTACAT ATTCAGTTTT ATTTCTCTCC 901 TTCGAATTAC ATTCACTCCC CAAAACCCTC TTCTCAATTC CCTGAGCGTC CTGCTGCAAG 961 ATTTACCATT CGTTTTTGTT AGACTTGGTT TAATCATTGC CCTGGGGACT ATCACACCCG 1021 TACTGGGCCT GTGTAAAAAT ATCCTCGTGA CTCTCTCTTA CATTTACTTC AATTACCTAA 1081 CCAGAATCAG GATTTTTTCT GCCTTTGAAA TGTCTCCATT TTTGCCAACT TTCTTGTACA 1141 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1201 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1261 AGGACGACTA ACTTAACGAT ATTTTCATAT AACGCGTTAA GTCgacaatc aacctctgga 1321 ttacaaaatt tgtgaaagat t