Construct: ORF TRCN0000479522
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018237.1_s317c1
- Derived from:
- ccsbBroadEn_04644
- DNA Barcode:
- GTGTTGACTCTAAGCTGATCTCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIF12 (113220)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479522
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 113220 | KIF12 | kinesin family member 12 | NM_138424.1 | 100% | 100% | |
| 2 | human | 113220 | KIF12 | kinesin family member 12 | XM_024447404.1 | 100% | 100% | |
| 3 | human | 113220 | KIF12 | kinesin family member 12 | XM_006716947.2 | 80.7% | 74.1% | 1_312del;1715_1734del;1872_1905del |
| 4 | human | 113220 | KIF12 | kinesin family member 12 | XM_024447408.1 | 78.8% | 78.8% | 1_414del |
| 5 | human | 113220 | KIF12 | kinesin family member 12 | XM_024447406.1 | 78.4% | 76.9% | (many diffs) |
| 6 | human | 113220 | KIF12 | kinesin family member 12 | XM_005251683.5 | 76.6% | 70.3% | 1_414del;1817_1836del;1974_2007del |
| 7 | human | 113220 | KIF12 | kinesin family member 12 | XM_024447405.1 | 76.5% | 73.3% | (many diffs) |
| 8 | human | 113220 | KIF12 | kinesin family member 12 | XR_002956749.1 | 66.9% | (many diffs) | |
| 9 | human | 113220 | KIF12 | kinesin family member 12 | XR_002956751.1 | 66.2% | 1_219del;1401_1566del;1660_1661ins264 | |
| 10 | human | 113220 | KIF12 | kinesin family member 12 | XR_002956750.1 | 64.1% | (many diffs) | |
| 11 | human | 113220 | KIF12 | kinesin family member 12 | XM_024447407.1 | 44.6% | 24.6% | 324_325ins157;651_731del;804_805ins659 |
| 12 | mouse | 16552 | Kif12 | kinesin family member 12 | XM_017320000.1 | 39.7% | 40.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1605
- ORF length:
- 1539
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gaggaccttc gcctggctgt tggaccgcgt gcagcacctg ggtgcccctg 121 tcacccttcg cgcctcttat ctggagatct acaatgagca ggttcgggac ttgctgagcc 181 tggggtctcc ccggcccctc cctgttcgct ggaacaagac tcggggcttc tatgtggagc 241 agctgcgggt ggtggaattt gggagtctgg aggccctgat ggaacttttg caaacgggtc 301 tcagccgtcg aaggaactca gcccacaccc tgaaccaggc ctccagccga agccatgccc 361 tgctcaccct ttacatcagc cgtcaaactg cccagcagat gccttctgtg gaccctgggg 421 agccccctgt tggtgggaag ctgtgctttg tggacctggc aggcagtgag aaggtagcag 481 ccacgggatc ccgtggggag ctgatgcttg aggctaacag catcaaccga agcctgctgg 541 ccctgggtca ctgcatctcc ctgctgctgg acccacagcg gaagcagagc cacatccctt 601 tccgggacag caagctcacc aagttgctgg cagactcact gggagggcgc ggggtcaccc 661 tcatggtggc ctgcgtgtcc ccctcagccc agtgccttcc tgagactctc agcaccctgc 721 gatatgcaag ccgagctcag cgggtcacca cccgaccaca ggcccccaag tctcctgtgg 781 caaagcagcc ccagcgtttg gagacagaga tgctgcagct ccaggaggag aaccgtcgcc 841 tgcagttcca gctggaccaa atggactgca aggcctcagg gctcagtgga gcccgggtgg 901 cctgggccca gcggaacctg tacgggatgc tacaggagtt catgctagag aatgagaggc 961 tcaggaaaga aaagagccag ctgcagaata gccgagacct ggcccagaat gagcagcgca 1021 tcctggccca gcaggtccat gcactagaga ggcgtctcct ctctgcctgc taccatcacc 1081 agcagggtcc tggcctgacc ccaccgtgtc cctgcttgat ggccccagct cccccttgcc 1141 atgcactgcc acccctctac tcctgcccct gctgccacat ctgcccactg tgtcgagtgc 1201 ccctggccca ctgggcctgc ctgccagggg agcaccacct gccccaggtg ttggaccctg 1261 aggccTCAGG TGGCAGGCCC CCATCTGCCC GGCCCCCACC CTGGGCACCC CCATGCAGCC 1321 CTGGCTCTGC CAAGTGCCCA AGAGAGAGGA GTCACAGTGA CTGGACTCAG ACCCGAGTCC 1381 TGGCAGAGAT GTTGACGGAG GAGGAGGTGG TACCTTCTGC ACCTCCCCTG CCTGTGAGGC 1441 CCCCGAAGAC ATCACCAGGG CTCAGAGGTG GGGCCGGGGT TCCAAACCTG GCCCAGAGAC 1501 TGGAGGCCCT CAGAGACCAG ATTGGCAGCT CCCTGCGACG TGGCCGCAGC CAGCCACCCT 1561 GCAGTGAGGG CGCACGGAGC CCAGGCCAAG TCCTCCCTCC CCATTGCCCA ACTTTCTTGT 1621 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1681 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1741 GAAAGGACGA GTGTTGACTC TAAGCTGATC TCCTACGCGT TAAGTCgaca atcaacctct 1801 ggattacaaa atttgtgaaa gatt