Transcript: Human XM_006716947.2

PREDICTED: Homo sapiens kinesin family member 12 (KIF12), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF12 (113220)
Length:
2279
CDS:
168..2075

Additional Resources:

NCBI RefSeq record:
XM_006716947.2
NBCI Gene record:
KIF12 (113220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116697 CCCTTTACATCAGCCGTCAAA pLKO.1 781 CDS 100% 4.950 6.930 N KIF12 n/a
2 TRCN0000116698 ACCCTTTACATCAGCCGTCAA pLKO.1 780 CDS 100% 4.050 5.670 N KIF12 n/a
3 TRCN0000420594 GAGCTGATGCTTGAGGCTAAC pLKO_005 912 CDS 100% 6.000 4.200 N KIF12 n/a
4 TRCN0000116700 ACAGGAGTTCATGCTAGAGAA pLKO.1 1346 CDS 100% 4.950 3.465 N KIF12 n/a
5 TRCN0000429643 AGCAGGTCCATGCACTAGAGA pLKO_005 1444 CDS 100% 3.000 2.100 N KIF12 n/a
6 TRCN0000116701 GAGATCTACAATGAGCAGGTT pLKO.1 558 CDS 100% 2.640 1.848 N KIF12 n/a
7 TRCN0000116699 CGGAACCTGTACGGGATGCTA pLKO.1 1326 CDS 100% 1.000 0.700 N KIF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04644 pDONR223 100% 80.7% 74.1% None 1_312del;1715_1734del;1872_1905del n/a
2 ccsbBroad304_04644 pLX_304 0% 80.7% 74.1% V5 1_312del;1715_1734del;1872_1905del n/a
3 TRCN0000479522 GTGTTGACTCTAAGCTGATCTCCT pLX_317 22.4% 80.7% 74.1% V5 1_312del;1715_1734del;1872_1905del n/a
4 TRCN0000491876 TACAGTCCCCTTAGTCTTTAATCT pLX_317 15.9% 80.7% 74.1% V5 1_312del;1715_1734del;1872_1905delinsG n/a
5 TRCN0000487930 ATGCCCCACTGGCGGGAGCGTTCG pLX_317 16.1% 80.7% 74.1% V5 (not translated due to prior stop codon) 1_312del;1715_1734del;1872_1905del n/a
Download CSV