Construct: ORF TRCN0000479582
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004613.1_s317c1
- Derived from:
- ccsbBroadEn_16049
- DNA Barcode:
- ACGGCACGTCTACTGCGTGGCGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZFYVE19 (84936)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479582
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | NM_001258420.2 | 81.2% | 80.8% | 1_225del;310T>C;922T>G |
| 2 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | NM_001077268.2 | 69.4% | 69.2% | (many diffs) |
| 3 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | NM_032850.5 | 69.2% | 68.1% | (many diffs) |
| 4 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | NM_001258421.2 | 57.4% | 57.3% | 0_1ins300;300_503del;601T>G |
| 5 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | XM_024450092.1 | 46.3% | 46.2% | 0_1ins432;168_371del;469T>G |
| 6 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | XM_017022684.2 | 37.7% | 28.4% | (many diffs) |
| 7 | human | 84936 | ZFYVE19 | zinc finger FYVE-type conta... | XR_931925.3 | 32.4% | (many diffs) | |
| 8 | mouse | 72008 | Zfyve19 | zinc finger, FYVE domain co... | NM_028054.3 | 68.6% | 67.5% | (many diffs) |
| 9 | mouse | 72008 | Zfyve19 | zinc finger, FYVE domain co... | XM_006500205.1 | 68.4% | 67.3% | (many diffs) |
| 10 | mouse | 72008 | Zfyve19 | zinc finger, FYVE domain co... | NM_001164827.1 | 55.7% | 54.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1050
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gagtaggtgc tacggctgcg ctgtcaagtt caccctcttc aagaaggagt 121 acggctgtaa gaattgtggc agggccttcc gttcaggctg cctaagcttc agtgcagcag 181 tgcctcggac tgggaacacc caacagaaag tctgcaagca atgccatgag gtcctgacca 241 gagggtcttc tgccaatgcc tccaagtggt caccacctca gaactataag aagcgtgtgg 301 cagccttgga agccaagcaa aagcccagca cttcccagag ccagggactg acacgacaag 361 accagatgat tgctgagcgc ctagcacgac tccgccagga gaacaagccc aagttagtcc 421 cctcacaggc agagatagag gcacggctgg ctgccctaaa ggatgaacgt cagggttcca 481 tcccttccac ccaggaaatg gaggcacgac ttgcagcgtt gcagggcaga gttctacctt 541 ctcaaacccc ccagccggca catcacacac cggacaccag gacccaagcc cagcagacac 601 aggatctgct aacgcagctg gcagctgagg tggctatcga tgaaagctgg aaaggaggag 661 gcccagtgac cctccaggac tatcgcctcc cagacagtga tgacgacgag gatgaggaga 721 cagccatcCA AAGAGTCCTG CAGCAGCTCA CTGAAGAAGC TGCCCTGGAT GAGGCAAGTG 781 GCTTTAACAT CCCTGCAGAG CAGGCTTCTC GACCCTGGAC GCAACCCCGC GGGGCAGAGC 841 CTGAGGCCCA GGATGTGGAC CCCAGGCCTG AGGCTGAGGA AGAGGAGCTC CCCTGGTGCT 901 GCATCTGCAA TGAGGATGCC ACCCTACGCT GCGCTGGCTG CGATGGGGAC CTCTTCTGTG 961 CCCGCTGCTT CCGAGAGGGC CATGATGCCT TTGAGCTTAA AGAGCACCAG ACATCTGCCT 1021 ACTCTCCTCC ACGTGCAGGC CAAGAGCACT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAACGGC 1201 ACGTCTACTG CGTGGCGTGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt